Alyco, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, New taxa of butterflies supported by genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (3), pp. 1-63 : 55-57

Alyco Grishin, new genus

http://zoobank.org/ 25B2623E-097A-45C7-8D2D-90D0DB7A9D0E

Type species. Styriodes quota Evans, 1955 .

Definition. Genomic phylogeny of Moncina A. Warren, 2008 reveals that a female from Guyana we identified as Styriodes quota Evans, 1955 (type locality in Guyana) ( Fig. 61, genitalia in Fig. 62) is in a different clade from Styriodes Schaus, 1913 (type species Styriodes lyco Schaus, 1913 ), currently a subgenus of Mnasicles Godman, 1901 (type species Mnasicles geta Godman, 1901 ), and originates in deep radiation among genera such as Eprius Godman, 1901 (type species Epeus veleda Godman, 1901 ), Lychnuchus Hübner, [1829] (type species Lychnuchus olenus Hübner, [1829] , which is a junior subjective synonym of Hesperia celsus Fabricius, 1793 ), and Mit Grishin , 2022 (type species Mnasitheus badius Bell, 1930 ), while not being particularly close to any of them ( Fig. 60) and in a different clade from Mnasicles (see Fig. 6 in Zhang et al. (2023g )). Therefore, the lineage with S. quota represents a new genus. This genus differs from its relatives by a combination of the following characters: males with a short rhomboidal brand of two segments, separated by the vein CuA 2; aedeagus with two long (slightly shorter than uncus) and arched symmetrical terminal processes; uncus is undivided, triangular in dorsal view and rather straight and narrow in lateral view; valva is elongated and rounded, with a Γ-shaped process directed dorsad (bending posteriad) from the middle of its ventral margin. In DNA, a combination of the following characters is diagnostic in the nuclear genome: aly10672.9.2:G159A, aly 1456.2.1:C129T, aly525.128.1:C631A, aly824.26.7:C69T, aly887.25.3:T111C, aly1656.17.1:T189T (not C), aly240.31.3:G63G (not C), aly451.7.7:C47C (not G), aly50.27.3:C79C (not T), aly208.49.1:C148C (not A), and COI barcode: 79C, T202G, T232C, A328T, A415T, T457C.

Barcode sequence of the type species. Sample

NVG-8044, GenBank PQ489718, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATACTAGGAACTTCTTTAAGTTTA

CTAATTCGAACAGAATTAGGCAATCCTGGTTCTTTAATTGGAGATGATCAAATTTATA

ATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTAT

AATTGGAGGATTTGGAAATTGATTAGTGCCTTTAATATTAGGAGCCCCAGATATAGCC

TTTCCACGAATAAATAATATAAGATTTTGAATATTACCCCCCTCACTATTATTACTAA

TTTCAAGAAGAATTGTTGAAAATGGTGCAGGAACTGGTTGAACTGTTTATCCCCCTTT

ATCTTCTAATATTGCTCATCAAGGTTCATCAGTTGACTTAGCAATCTTTTCTTTACAT

TTAGCTGGTATTTCCTCTATTTTAGGAGCTATTAATTTCATTACTACAATCATTAATA

TACGAATCAAAAACATATCATTTGATCAAATACCCTTATTTGTTTGATCAGTAGGAAT

TACAGCTTTATTATTATTATTATCTTTACCTGTATTAGCAGGAGCTATTACAATACTT

CTCACTGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCCGGAGGAGGAGATCCTA

TTTTATATCAACATTTATTT

Etymology. The name stems from a misidentification we spotted in the USNM collection: a specimen of the type species was identified as

Fig. 62. Genitalia of Alyco quota comb. nov. ♀ NVG-8044, “ Styriodes lyco ”. Negating a- was added to lyco to

vial NVG170208-29, data in Fig. 61 legend: a) ventral and b) form the genus name, which is treated as a right ventrolateral views of sterigma (scale below), c) feminine noun in the nominative singular. complete genitalia in ventral view (scale on the right).

Parent taxon. Subtribe Moncina A. Warren, 2008 .

Comment. As far as we know, females of Alyco quota comb. nov. have not been reported. We take this opportunity to illustrate the female genitalia of this rarely encountered species (Fig. 62). An unusual feature of the female genitalia is lamella antevaginalis, which is ventrally expanded into a structure resembling an octopus sucker on a tentacle.