Stinga azteca, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, New taxa of butterflies supported by genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (3), pp. 1-63 : 52-53

Stinga azteca Grishin, new species

http://zoobank.org/ C6F5C6FC-A5D2-4654-BF07-11C3D05F694B

( Figs. 54 part, 55–56)

Definition and diagnosis. Genomic phylogeny of Stinga Evans, 1955 (type species Pamphila morrisoni W. H. Edwards, 1878 ) reveals that specimens from southern Mexico identified as Stinga morrisoni (W. H. Edwards, 1878) (type locality USA: Colorado, likely in Custer Co.) are genetically differentiated from it at the species level ( Fig. 54) and represent a new species. The COI barcodes are 2.3% (15 bp) different between the holotype of the new species and the lectotype of S. morrisoni . This new species keys to M.9. in Evans (1955) and differs from S. morrisoni by characters described in Warren and Austin (2009) for the phenotype “in the states of México, Tlaxcala, Guerrero and Oaxaca.” In brief, specimens of the new species are smaller than S. morrisoni in the southern parts of its range and prominently darker, with a deeper orange color, smaller spots, and reduced pale overscaling. In male genitalia ( Fig. 5c in Warren and Austin 2009), the harpe is better separated from the ampulla than in S. morrisoni , and the valva is somewhat narrower. In female genitalia ( Fig. 6c in Warren and Austin 2009), lamella postvaginalis narrows towards ductus bursae stronger than in S. morrisoni . Due to unexplored phenotypic variation in other populations, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly2874.23.3:C1218T, aly2874.23.3:C1296T, aly11945.4. 2:C573T, aly11945.4.2:A1341C, aly1838.49.7:A939G, and COI barcode: A199A, C235T, A307G, T361C, T553C.

Barcode sequence of the holotype. Sample NVG-23046D06, GenBank PQ489716, 658 base pairs: AACCTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACC ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCACCAGATATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGAATACTACCCCCTTCATTAACATTATTAATTTCAAGAAGAATTGTGGAAAATGGTGCAGGAACAGGATGAACAGTTTACCCCCCTTTATCCTCAAATATCGC TCATCAAGGATCCTCTGTTGATTTAGCAATTTTTTCTCTTCATTTGGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCA TTTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCCGTTTTAGCAGGTGCTATTACTATATTACTTACTGATCGAAATTTAAATACTT CTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 55, bears five printed (text in italics handwritten) labels: four white [ MEXICO: MÉXICO: | Mpio. Amecameca: | S slope Iztaccihuatl: | grassy slopes above | Paso de Cortes, 3400- | 3900m, 18-III-2000 | Andrew D. Warren | with MZFC crew], [Genitalic Vial | GTA- 14079], [A. D. Warren colln. | MGCL Accession | #2009-7], [DNA sample ID: | NVG-23046D06 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Stinga azteca | Grishin ]. Paratype: 1♀ NVG-23046D07 the same data as the holotype, genitalic vial GTA-14078.

Type locality. Mexico: México, Mpio. Amecameca, south slope of Iztaccihuatl, grassy slopes above Paso de Cortés , 3400–3900 m .

Etymology. The Aztec Empire flourished in central Mexico, with their capital city, Tenochtitlan, built on an island in Lake Texcoco, which is now largely filled in and forms the base of modern-day Mexico City. This species is known from central Mexico, hence the name. The name is a feminine noun in apposition.

Distribution. Southern Mexico ( México, Tlaxcala, Puebla, Guerrero, and Oaxaca).