Quasimellana duranga, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, New taxa of butterflies supported by genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (3), pp. 1-63 : 50-52

Quasimellana duranga Grishin, new species

http://zoobank.org/ 513B0D2D-9275-4954-BE64-4E38660698AA

( Figs. 51 part, 52–53)

Definition and diagnosis. Genomic analysis reveals that a specimen from Durango, Mexico, identified as Quasimellana mulleri (E. Bell, 1942) (type locality in Mexico: Guerrero) is genetically differentiated from it at the species level ( Fig. 51), e.g., their COI barcodes differ by 5.3% (35 bp) and therefore represents a new species. This species differs from its relatives by being darker: dorsally, two subapical orange spots are separated from the costal orange area and not connected to it through additional orange spots; ventrally, forewing dark scaling is more extensive, and the hindwing has darker marginal and basal areas giving an appearance of a faint wide central paler band (not uniformly yellow) ( Fig. 52); the cornutus has a more triangular keel, rather than terminally rounded or trapezoidal, the body of cornutus is narrower; dorsodistal end of harpe is rounded and projects dorsad from the costa of the valva being separated from it by a rounded concavity ( Fig. 53). Due to the cryptic nature of this species and the following base pairs is diagnostic in the nuclear genome: aly 2631.8.5: T297 C, aly668.9.2:A372G, aly668.9.2:A384T, aly668.9.2: T393 G, aly82.25.3:C63T, aly1603.75.15: T111 T (not G) , aly361.11.2: A321A (not T), aly361.25.3:A102A (not G), aly3824.6.7:C69C (not A), aly3824.6.7:C72C (not T), and COI barcode: T38 T, T46 C, 79 T, A286 T, T304 C, T500 C.

Barcode sequence of the holotype. Sample NVG-18117G05, GenBank PQ489715, 658 base pairs: TACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGTACCTCCTTAAGTCTTCTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCCTTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAA TAAATAACATAAGATTTTGAATGCTACCCCCATCATTAACCCTTCTAATTTCAAGAAGTATCGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTACCCCCCCCTATCTTCTAATATCGC TCATCAAGGATCTTCTGTAGATTTAGCAATTTTTTCACTTCACTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAACTTATCA TTTGATCAAATATCTCTATTTATTTGATCAGTAGGAATTACAGCATTATTATTATTATTATCTTTACCAGTTTTAGCTGGAGCTATTACCATATTACTTACAGACCGAAATTTAAACACAT CATTCTTCGATCCAGCAGGAGGGGGGGATCCCATTCTATACCAACACTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 52 (genitalia in Fig. 53), bears the following seven rectangular labels (1 st, 2 nd, and 6 th handwritten, others printed with handwritten text shown in italics), five white: [Dgo, rte 40 | Mimbres Gor | ge 28 Aug 85 | DDM], [ Mellana ♂ | mulleri | Bell | det. H.A.Freeman], [GENITALIA NO. | X- 31 78 | J.M.Burns 1991], [ Quasimellana mulleri | (Bell) | ♂ | det. J. M. Burns 1994], [DNA sample ID: | NVG-18117G05 | c/o Nick V. Grishin ], and two red [ LENT BY | DOUG MULLINS | VII-91], [HOLOTYPE ♂ | Quasimellana | duranga Grishin]. The holotype was collected by Doug Mullins.

Etymology. The name is formed from the name of the Mexican state with the type locality and is treated as a feminine noun in apposition.

Distribution. Currently known only from the holotype collected in Durango, Mexico.