Notamblyscirtes durango seaza, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, New taxa of butterflies supported by genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (3), pp. 1-63 : 49-50

Notamblyscirtes durango seaza Grishin, new subspecies

http://zoobank.org/ 44D73157-48E8-411C-B5D3-E53D8CBD049A

( Figs. 49 part, 50)

Definition and diagnosis. Genomic analysis of additional Notamblyscirtes J. Scott, 2006 (type species Amblyscirtes simius W. H. Edwards, 1881 ) specimens from across its range reveals that populations of Notamblyscirtes durango J. Scott, 2017 (type locality in Mexico: Durango) partition into two clades by their nuclear genome ( Fig. 49a, b, red and purple), thus being genetically differentiated from each other, albeit with moderate statistical support (minimal of four clades over two trees is 60% replications). Therefore, these groups of populations represent major genomic groups of N. durango below the species level, and thus correspond to subspecies. These subspecies do not consistently differ in mitochondrial DNA ( Fig. 49c). The nominate subspecies, as the trees demonstrate ( Fig. 49 purple), is known only from Mexico: states of Nuevo Leon, Coahuila, and Durango. The second subspecies inhabits southeastern Arizona and southwestern New Mexico ( Fig. 49 red), does not have a name associated with it, and hence is new. The new subspecies possesses the characters given for N. durango in the original description ( Scott et al. 2017) and is most similar to the nominate subspecies from Mexico in its darker aspect compared to its sister species Notamblyscirtes simius (W. H. Edwards, 1881) (type locality in USA: Colorado, Pueblo Co ,), but differs in being somewhat paler (e.g., towards the base and inner margin of and typically brighter orangish postdiscal area on ventral forewing), and with sharper-defined pale spots on ventral hindwing, especially in females. Due to phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly331.20.14:C144T, aly331.20.14:G180A, aly4237.1.2:C21T, aly164.66.3:A39G, aly164. 66.3:C57T. There are no differences in the COI barcode.

Barcode sequence of the holotype. Sample NVG-22094G07, GenBank PQ489714, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCATTAAGTTTATTAATTCGTACAGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGAATATTACCCCCTTCTTTAACACTTTTAATCTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCACTATCATCTAATATTGC CCATCAAGGATCTTCTGTTGATATAGCAATTTTCTCCCTTCATCTAGCTGGAATTTCATCTATCTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCA TTTGATCAAATACCCTTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACAGATCGTAATTTAAATACCT CTTTTTTTGACCCCGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the Los Angeles County Museum of Natural History, Los Angeles, CA, USA ( LACM), illustrated in Fig. 50, bears the following five rectangular labels (2 nd handwritten, others printed with handwritten text shown in italics), four white: [Research Ranch RAB | 6 mi. S.E. Elgin, AZ. | Santa Cruz Co. | Col. 27-Jul-1983], [ A. simius ], [ Amblyscirtes simius | Edwards |

det. Richard Bailowitz], [DNA sample ID: | NVG-22094G07 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Notamblyscirtes durango | seaza Grishin ]. Paratypes: 2♂♂ and 4♀♀ USA: Arizona: Santa Cruz Co., San Rafael Valley, Bog Hole, J. P. Brock leg. [JPBrock]: 1♂ NVG-21057H03 9-Aug- 1992 , 1♂ NVG-21057H04 20-Aug-1994, 1♀ NVG-21057H05 7-Aug-1993; 1♀ NVG-21044B05 Cochise Co., Peloncillo Mts., Cottonwood Canyon , 16-Aug-1990 , J. B. Walsh leg. [ MGCL]; New Mexico, Hidalgo Co., Clanton Draw, 4 mi E of AZ state line, K. Roever leg. [ MGCL]: 1♀ NVG-23047H10 8-Aug- 1982 and 1♀ NVG-23047H11 1-Aug-1986.

Type locality. USA: Arizona, Santa Cruz Co., 6 mi SE of Elgin, Research Ranch.

Etymology. The name is formed from SE AZ (southeastern Arizona) for the type locality of this subspecies and is treated as a feminine noun in apposition.

Distribution. Southeastern Arizona (Cochise and Santa Cruz Cos.) and southwestern New Mexico (Hidalgo Co.), USA.

Comment. Traditionally, subspecies in butterflies have been defined by the differences in wing patterns between groups of populations that account for approximately 70% of specimens. We propose a more comprehensive definition of subspecies as major genetic groups of populations within a species and apply this definition to N. durango . This definition is all-encompassing because it does not rely on a single feature of an organism, such as the coloration of adults, but is an integral characteristic of the genome and is expected to reflect genetic differences between other life stages, such as caterpillars and pupae, behavior, and foodplant preferences. Subspecies, defined as major genomic clusters, represent genetically unique divisions of a species and thus may be more relevant as units considered for conservation.