Vertica ( Brasta ) asta, Zhang & Cong & Shen & Song & Grishin, 2024
|
publication ID |
2643-4806 |
|
persistent identifier |
https://treatment.plazi.org/id/E87A9B1F-9A40-8538-FE30-298F66A595BC |
|
treatment provided by |
Felipe |
|
scientific name |
Vertica ( Brasta ) asta |
| status |
new species |
Vertica ( Brasta) asta Grishin, new species
http://zoobank.org/ 055F4CF8-5498-47F7-B800-D17EE25F3A36
( Figs. 63 part, 64)
Definition and diagnosis. Genomic analysis reveals that a specimen from Colombia identified as belonging to the subgenus Brasta Grishin, 2022 ( type species Lychnuchus brasta Evans, 1955 ) of the genus Vertica Evans, 1955 ( type species Hesperia verticalis Plötz, 1882 ) is genetically differentiated from the only known species in the subgenus Vertica ( Brasta) brasta ( type locality in Peru: Chanchamayo) at the species level ( Fig. 63): e.g., their COI barcodes differ by 6.1% (40 bp). In the presence of phenotypic differences, this specimen represents a new species. This new species is closest to “ Lychnuchus brasta ” (K.12.3) and keys to it in Evans (1955) but differs by wider pale (cream-yellow) markings: broader central band (partly hyaline) on the forewing that is nearly oval rather than narrow-rectangular, beneath extending to the inner margin with a wide (nearly 2/5 of the wing length) pale spot; a wider pale spot at the hindwing apex, as well as the marginal pale stripe on ventral hindwing, the inner margin of the stripe is close to straight, not curving along the outer wing margin. Due to unexplored phenotypic variation in this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly116.29.8:C117T, aly905.4.1:A801G, aly 2700.2.4:C45T,
C42C (not T), aly1038.16.2:C198C (not A), aly182.2.2:C99C (not T), and COI barcode: T16C, A40C, T193C, A412G, T421C, T589C.
Barcode sequence of the holotype. Sample NVG-23093E12, GenBank PQ489719, 658 base pairs: AACTTTATATTTTATCTTTGGTATCTGAGCAGGTATAGTCGGAACTTCTCTCAGAATATTAATTCGAACAGAATTAGGTAATCCCGGATCTTTAATCGGAGATGATCAAATTTATAACACT ATCGTTACTGCTCACGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGTTTTGGAAACTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGAATGTTGCCCCCCTCTTTAACCCTTTTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTATACCCCCCACTTTCATCTAATATTGC TCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCATTACACTTAGCGGGAATTTCCTCAATTTTAGGAGCAATTAATTTTATTACCACAATTATTAATATACGAATTAAAAATATATCA TTTGATCAAATACCCCTATTTATTTGATCAGTTGGAATTACAGCTTTATTATTAATTTTATCTTTACCAGTATTAGCTGGAGCTATTACAATACTTCTTACTGACCGAAATTTAAATACCT CCTTTTTTGATCCTGCAGGAGGAGGAGATCCAATCCTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the collection of the Zentrum für Biodokumentation des Saarlandes, Schiffweiler, Germany (ZfBS), illustrated in Fig. 64, bears the following five rectangular labels (2 nd handwritten, 3 rd without text, others printed; 3 rd and the last red, others white): [ Rio Aguacatal | Colomb. W.Codr. | 2000 m | Coll. Fassl], [?], [] no text on this red label, [DNA sample ID: | NVG-23093E12 | c/o Nick V. Grishin ], [ HOLOTYPE ♂ | Vertica (Brasta) | asta Grishin].
Type locality. Colombia: Valle del Cauca, Río Aguacatal , elevation ca. 2000 m .
Etymology. The name is formed from its sister species name, which is made shorter to indicate a more northern distribution of this species. The name is treated as a noun in apposition.
Distribution. Currently known only from the holotype collected in western Colombia.
| V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
