Lasaia sessilis oaxacensis, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, Taxonomic advances driven by the genomic analysis of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (7), pp. 1-43 : 16-17

Lasaia sessilis oaxacensis Grishin, new subspecies

http://zoobank.org/ B74DED29-8359-4AF6-AB20-E564AC968987

( Figs. 13 part, 14)

Definition and diagnosis. Genomic analysis of Lasaia H. Bates, 1868 (type species Papilio meris Stoll, 1781 ) reveals that a specimen from Oaxaca, Mexico ( Fig. 13 magenta, 14) is genetically differentiated from Lasaia sessilis Schaus, 1890 (type locality in Mexico: Veracruz, Coatepec, syntype sequenced as NVG-18048A05) ( Fig. 13 blue), but not very prominently, e.g., their COI barcodes differ by 1.4% (9 bp). Therefore, this specimen represents a new taxon that we regard as a subspecies. This new subspecies is most similar to L. sessilis but differs from it by forewing dark dashes that are narrower, more connected with each other (rather than forming separate spots), and weaker developed than in L. sessilis , but hindwing dashes are better expressed on the dorsal side, especially towards the inner margin where they typically fade in L. sessilis , and costal area of dorsal hindwing paler than in a typical L. sessilis . Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne3288.5.1:C402G, cne205.20.3:T84C, cne640. 6.18:A55G, cne640.6.18:T75C, cne7.2.1:T15A, cne7425.7.4:A24A (not G), cne 1806.4.1:T119T (not C), cne790.10.6: C57C (not G), cne10214.8.11:G63G (not A), cne49345.1.3:T60T (not C) and in COI barcode: T49A, A241A, A295A, T403C, T616C.

Barcode sequence of the holotype. Sample NVG-19069B11, GenBank PP254250, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCATTAAGTTTATTAATTCGTATAGAATTAGGTATACCAGGATCATTAATTGGTGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATCATAATTGGAGGTTTTGGAAATTGATTAGTACCATTAATATTAGGAGCACCTGATATAGCATTTCCACGAA TAAATAATATAAGATTCTGACTTCTTCCCCCATCTTTATTTCTTTTAATTTCAAGAAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCACTGTCTTCTAATATTGC TCATAGAGGATCCTCAGTAGATTTAGCTATTTTTTCTCTCCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAATAATTTATCT TTTGATCAAATACCATTATTTATCTGATCAGTTGGTATTACTGCTTTATTATTATTATTATCTTTACCAGTTTTAGCAGGAGCTATTACAATATTATTAACAGACCGTAATTTAAATACAT CTTTTTTTGACCCAGCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the University of Texas Biodiversity Center insect collection, Austin, TX, USA [ TMMC], illustrated in Fig. 14, bears five labels: 3 rd handwritten, others printed; 2 nd and 5 th red, others white: [ Mexico: Oaxaca, | La Soledad – Buena Vista | ~5000' 5-6.v.1990 | J. Kemner leg. #200], [Texas Memorial | Museum –UTexas | JKemner Spec. | 1197], [200], [DNA sample ID: | NVG-19069B11 | c/o Nick V. Grishin ], and [HOLOTYPE ♂ | Lasaia sessilis | oaxacensis Grishin ]. The numbers 1197 and 200 refer to the specimen and the locality, respectively, in the Kemner files in TMMC collection. The first label was made for the holotype using data in these files and added to the specimen together with the last (holotype) label. Only the 2 nd and 3 rd labels were original labels on this specimen.

Type locality. Mexico: Oaxaca, Sierra Madre del Sur , La Soledad – Buena Vista, elevation ca. 5000 ’.

Etymology. The name refers to the type locality and is a feminine adjective.

Distribution. Currently known only from the holotype collected in Oaxaca, Mexico.

Comment. Further research and additional specimens are needed to investigate whether L. sessilis oaxacensis ssp. n. could be a species-level taxon.