Synargis reginella, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, Taxonomic advances driven by the genomic analysis of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (7), pp. 1-43 : 19-20

publication ID

2B44E674-0784-4977-ADE5-A8AD69E30582

publication LSID

lsid:zoobank.org:pub:2B44E674-0784-4977-ADE5-A8AD69E30582

persistent identifier

https://treatment.plazi.org/id/C45B002E-FFFD-FF99-E1E5-ACC572EF3114

treatment provided by

Felipe

scientific name

Synargis reginella
status

new species

Synargis reginella Grishin, new species

http://zoobank.org/ 8F95EA60-6CD3-4B47-93CA-78E8E3A130B0 ( Figs. 15 part, 16b)

Definition and diagnosis. Several specimens from the S. regulus group collected in Brazil: Pará ( Fig. 15 green) are genetically distinct from all others at the species level, e.g., COI barcode difference from their sister S. regina sp. n. ( Fig. 15 magenta) is 2.3% (15 bp). Therefore, they represent a new species. This new species differs from its relatives by broader yellow bands and submarginal yellow macules, which are ventral side (including a comparatively large yellow spot in cell M3-CuA1) fully penetrating the brown border and connected with the postdiscal yellow area, and dorsally brown abdomen in males. Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne294.1.1:G44T, cne294.1.1:C59G, cne 2806.2.1: T90C, cne935.2.3:G351A, cne935.2.3:C354T and in COI barcode: A94G, C235T, T283C, T454C, T646C. Barcode sequence of the holotype. Sample NVG-22117E03, GenBank PP254252, 658 base pairs: AACTTTATATTTTATTTTTGGAATCTGAGCAGGTATAATAGGAACATCTCTTAGTTTATTAATTCGAATAGAATTAGGAATTCCTGGTTCTTTGATTGGAAATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCTCCATCTTTATTCTTATTAATTTCTAGAAGAATTATTGAAAATGGAGCAGGAACTGGATGAACTGTATATCCCCCACTTTCATCTAATATTGC TCATGGAGGAGCTTCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGTGCAATTAATTTTATTACAACCATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTTTATTTATTTGATCTGTAGGAATTACTGCTCTTCTTCTTTTATTATCTTTACCTATTTTAGCAGGAGCTATTACTATACTACTTACAGATCGAAATTTAAATACAT CTTTTTTTGACCCCGCAGGAGGTGGAGATCCAATTTTATACCAACATTTATTT

Type material. Holotype: ♀ currently deposited in the collection of Museum für Naturkunde, Berlin, Germany [ MFNB], illustrated in Fig. 16b, bears four printed labels: three white [Itait. | Mich.], [ex coll. | H. STICHEL], [DNA sample ID: | NVG-22117E03 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Synargis | reginella Grishin]. According to the 1 st label, the holotype was collected in Itaituba (Pará, Brazil) by Michael, probably in 1890. This year is on a similarly styled label of the topotypical paratype. A female is chosen as the holotype for best comparison with female primary types of S. regina sp. n. and Jones’ drawing S. regulus . Paratypes: 2♂♂ and 2♀♀ from Brazil, Pará [ MFNB]: 1♂ the same data as the holotype, 1890 (NVG-22117D07) and from Santarem: 1♂ (NVG-22117E01, Stichel collection number 1620), 1♀ (NVG-22117E02, Stichel No 2088), and 1♀ (NVG-22117E04, Stichel No 315).

Type locality. Brazil: Pará , Itaituba .

Etymology. In Latin, regulus means little king or prince. It is a diminutive form of rex, which means king. In Latin, reginella is a diminutive of regina , which means queen, and the name is given to this species that resembles regina but is not that bright. The name is a noun in apposition.

Distribution. Lower Amazonian region.

MFNB

Museo Friulano di Storia Naturale

V

Royal British Columbia Museum - Herbarium

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

Family

Riodinidae

Genus

Synargis

Darwin Core Archive (for parent article) View in SIBiLS Plain XML RDF