Synargis regina, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, Taxonomic advances driven by the genomic analysis of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (7), pp. 1-43 : 18-19

Synargis regina Grishin, new species

http://zoobank.org/ 0AD77735-F840-4304-BD2A-5562AC4181AC ( Figs. 15 part, 16a)

Definition and diagnosis. A sole specimen from the S. regulus group that we sequenced from Chanchamayo, Peru ( Fig. 15 magenta) is genetically differentiated from its sister clade composed of specimens from Brazil: Pará (which belong to another new species described below) ( Fig. 15 green) at the species level: e.g., their COI barcodes differ by 2.3% (15 bp). Therefore, this female with a unique phenotype ( Fig. 16a) represents a new species. This new species differs from its relatives by extensive and broad yellow areas on wings (even broader than in S. regulus ), including broader submarginal macules on the forewing that are nearly touching each other, narrower broad bands, smaller marginal yellow spots on ventral side near each wing’s tornus (absent in S. regulus ) and lacking yellow marginal spot in cell M 3 - CuA 1 (absent in S. regulus but present in species with broad yellow bands). Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne30383.1.1:C324T, cne30383.1.1:A327C, cne2564.25.13:G51A,

cne3039.2.4:C36T, cne3039.2.4:A141T, cne 2462.3.2:C153C (not T), cne8137.3.1:G420G (not T), cne5683.4.1: T929 T (not A) , cne17882.2.1:A79A (not G), cne 1029.3.3:C114C (not T) and in COI barcode: T85 C, G337G, T400 C, A562G, A619C.

Barcode sequence of the holotype. Sample NVG-22117D06, GenBank PP254251, 658 base pairs: AACTTTATATTTTATTTTTGGAATCTGAGCAGGTATAATAGGAACATCTCTTAGTTTATTAATTCGAATAGAATTAGGAATTCCCGGTTCTTTAATTGGAAATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCAGATATAGCTTTCCCTCGTA TAAATAATATAAGATTTTGATTATTACCCCCATCTTTATTTTTATTAATTTCTAGAAGAATTATTGAAAATGGAGCAGGAACTGGATGAACTGTGTACCCCCCACTTTCATCTAATATTGC TCATAGAGGAGCTTCTGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGTGCAATTAATTTTATTACAACTATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTTTATTTATTTGATCTGTAGGAATTACTGCTCTTCTTCTTTTATTATCTTTACCTGTTTTAGCGGGAGCTATTACTATACTACTTACAGATCGAAATTTAAATACAT CTTTTTTTGATCCCGCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♀ currently deposited in the collection of Museum für Naturkunde, Berlin, Germany [ MFNB], illustrated in Fig. 16a, bears five labels: 2 nd handwritten and others printed; 1 st green, 5 th red, and others white [Chanchamayo | G.Tessmann], [spec. | (cf. zonata) | ♀ | 583] (the number is rotated 90° counterclockwise relative to the rest of the text and written along the right side of the label), [ex coll. | H. STICHEL], [DNA sample ID: | NVG-22117D06 | c/o Nick V. Grishin ], and [HOLOTYPE ♀ | Synargis | regina Grishin].

Type locality. Peru: Chanchamayo .

Etymology. In Latin, regulus means little king or prince. It is a diminutive form of rex, which means king. In Latin, regina means queen, and this name is given to this brightest species of the group. The name is a noun in apposition.

Distribution. Currently known only from the holotype collected in central Peru.