Synargis flavicauda, Zhang & Cong & Shen & Song & Grishin, 2024
|
publication ID |
2B44E674-0784-4977-ADE5-A8AD69E30582 |
|
publication LSID |
lsid:zoobank.org:pub:2B44E674-0784-4977-ADE5-A8AD69E30582 |
|
persistent identifier |
https://treatment.plazi.org/id/C45B002E-FFFA-FF9B-E1E9-AE2272DC3499 |
|
treatment provided by |
Felipe |
|
scientific name |
Synargis flavicauda |
| status |
new species |
Synargis flavicauda Grishin, new species
http://zoobank.org/ BA27EC2B-4A69-4C68-8273-F82B8FCE2E74 ( Figs. 15 part, 17a)
Definition and diagnosis. Genomic analysis of the S. regulus group reveals a clade that, being distinct from all other species, itself consists of three species-level undescribed taxa ( Fig. 15 red, purple, and orange). The first species ( Fig. 15 red) with specimens sequenced from Peru differs in COI barcode from each of the other two species by 2.6% (17 bp). This new species is differentiated from its relatives by narrower than in several others yellow bands and submarginal macules, strongly developed marginal yellow spots inside brown border on the ventral side of wings, including the spot in cell M 3 -CuA 1; this spot is connected or nearly connected with the subapical elongated macule. Many males have a dorsally yellow caudal half of the abdomen (yellow ventrally as in other species). Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne664.10.2:C508A, cne664.10.2:C519 T , cne 2800.7.1:C655G, cne 2800.7.1:C660A, cne9234.1.8: T88 C and in COI barcode: T103 C, C340 T, T407 C, A451C, T578 C.
Barcode sequence of the holotype. Sample NVG-22117E05, GenBank PP254253, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCTCTTAGTTTACTAATTCGAATAGAATTAGGAACTCCTGGATCTTTAATTGGAGACGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTTTATTTTTATTAATCTCCAGAAGAATTGTTGAAAATGGAGCAGGAACTGGATGAACAGTATATCCCCCACTTTCATCTAATATTGC TCATAGAGGAACTTCTGTTGATTTAGCTATTTTTTCTCTTCATCTAGCTGGAATTTCATCAATCTTAGGTGCAATTAATTTTATTACCACTATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTTTATTTGTTTGATCAGTAGGAATTACTGCTCTTCTTCTTTTATTATCATTACCTGTTTTAGCGGGAGCTATTACTATACTACTTACTGATCGAAATTTAAACACAT CTTTTTTTGATCCTGCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ currently deposited in the collection of Museum für Naturkunde, Berlin, Germany [ MFNB], illustrated in Fig. 17a, bears four labels: 2 nd handwritten and others printed; 1 st green, 4 th red, and others white [Mt. Alegre, Rio | Pachitea O. Peru | G.Tessmann], [regulus F. | f. sylvarum Bat.], [DNA sample ID: | NVG-22117E05 | c/o Nick V. Grishin ], and [ HOLOTYPE ♂ | Synargis |
22117D04 and NVG-22117E06) and 1♂ from Peru: Chanchamayo, G. Tessmann leg. (NVG-22117D05) .
Type locality. Peru: Rio Pachitea, Monte Alegre. This is also the type locality of Pseudophaloe tessmanni Hering, 1925 ( Erebidae : Arctiinae) and Hylesia natex Draudt, 1929 ( Saturniidae ).
Etymology. In Latin, flavus means yellow or golden, and cauda means tail. The compound word flavicauda refers to the yellow distal half of the abdomen dorsal side in males of this species. This coloration may also be present in other species of the group but is typically less pronounced. The name is an adjective.
Distribution. Central and East-central Peru.
| T |
Tavera, Department of Geology and Geophysics |
| MFNB |
Museo Friulano di Storia Naturale |
| V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
