Cupido (Everes) comyntas orientalis, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, Taxonomic advances driven by the genomic analysis of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (7), pp. 1-43 : 27-28

Cupido (Everes) comyntas orientalis Grishin, new subspecies

http://zoobank.org/ 7169288F-1A58-4B26-8776-F2566A73DB1B

( Figs. 20 part, 21)

Definition and diagnosis. As detailed above, the nominate Cupido comyntas (Godart, [1824]) is the western subspecies with a likely type locality in California. As a result, no available name applies to the eastern USA subspecies formerly known as “ Cupido comyntas comyntas ”. Only two names, both infrasubspecific, have been proposed for the eastern US populations. Everes comyntas ab. watermani Nakahara, 1926 (from New York, Tompkins Co., Ithaca) is infrasubspecific according to the ICZN Art. 45.6.2 because it refers to an aberration ("ab.") ( ICZN 1999). Everes comyntas f. meinersi W. D. Field, 1938 (from Kansas. Douglas Co. Lawrence) is infrasubspecific because, in accord with the ICZN Art. 45.6.4, the “author expressly used … "f."” and “also expressly gave it infrasubspecific rank” by stating that “This is the spring brood” ( Field 1938). According to the ICZN Glossary, “infrasubspecific entity” refers to “Specimen(s) within a species differing from other specimens in consequence of intrapopulation variability … (e.g. … seasonal forms, … or … differing generations)” ( ICZN 1999). The spring brood is a different generation within a species and a seasonal form. Furthermore, the name meinersi has not been used as a valid name for a species or subspecies (Art. 45.6.4.1). Therefore, the eastern US subspecies of C. comyntas is new and is described here.

The eastern subspecies ( Fig. 20 green) is genetically differentiated from the nominate C. comyntas , which forms a clade sister to other populations ( Fig. 20 purple), and the COI barcode difference between the western and eastern subspecies is 0.6% (4 bp). The eastern subspecies is closer genetically to the southern Cupido comyntas texana (F. Chermock, 1945) (type locality USA: Texas, Bexar Co., near San Antonio) ( Fig. 20 blue), but forms a clade distinct from it ( Fig. 20 green), although their COI barcodes generally do not differ but by one or two base pairs. This new subspecies differs from other C. comyntas subspecies by the following characters: darker and browner (vs. grayer) ventral side of wings with more distinct whitish framing of dark spots; typically a complete row of marginal and submarginal spots beneath, particularly on the forewing (these spots are usually poorly expressed or lacking towards the apex in other subspecies); and brighter orange (vs. paler and yellower) ventral hindwing tornal crescents ( Fig. 21). See further details in Austin (2002), who referred to C. comyntas comyntas by the name of its junior subjective synonym, sissona , and to the new subspecies as “ comyntas comyntas .” A combination of the following DNA characters is diagnostic in the nuclear genome: cce 2265.4.2:G66A, cce 2896.5.6:A57G, cce 2896.5.6:T84G, cce13103.2.4:C74T, cce13103.2.4:C59A and in COI barcode differs from the nominate subspecies by: 412A, 508T, 556A, 641T (COI barcodes do not generally differ from C. comyntas texana ).

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTTTAAGAATCTTAATTCGAATAGAATTAGGAACTCCAGGCTCATTAATTGGAGATGATCAAATTTATAATACT ATTGTCACAGCTCATGCTTTTATTATAATTTTTTTCATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGTGCTCCAGATATAGCATTTCCTCGAA TAAATAATATAAGATTTTGATTATTACCTCCATCATTAATATTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCAAATATTGC CCATGGAGGATCATCTGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATCTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAGTTAATAATTTATCA TTTGATCAAATATCTCTATTTATTTGAGCTGTAGGAATTACAGCATTATTATTATTATTATCATTACCTGTATTAGCTGGGGCTATTACAATATTATTAACTGATCGAAATTTAAATACCT CATTTTTTGATCCTGCTGGAGGAGGAGACCCAATCTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [ MGCL], illustrated in Fig. 21, bears five printed labels: four white [ NC: Mecklenburg Co. | Charlotte, W. Arrowood Rd & | Green Ridge Dr, near Sugar Creek May 20, 2022 | Leg: W. Dempwolf], [ Cupido comyntas | ♂ | Coll of: W R Dempwolf], [DNA sample ID: | NVG-22058F01 | c/o Nick V. Grishin ], [ WRD 20,914], and one red [HOLOTYPE ♂ | Cupido comyntas | orientalis Grishin]. Paratypes: 6♂♂ and 4♀♀ from USA: 1♂ Virginia, Rockingham Co., Briery Branch Rd., 7.3 mi WNW Briery Branch, GPS 38.4734, −79.2042, 07-May-2016, N. V. Grishin & Q. Cong leg. (NVG-6090); 1♀ Indiana, Montgomery Co., Shades State Park, 39.9312, −87.0666, N. V. Grishin , 1-Aug-2015 (NVG-4239); 1♂ Arkansas, Montgomery Co., Ouachita National Forest, Big Brushy Creek, along NF6, GPS 34.6589, −93.8345, 4-Jul-2015, N. V. Grishin leg. (NVG-3888); 1♂ Oklahoma, Atoka Co., McGee Creek, GPS 34.3737, −95.8886, 11-Jul-2017, N. V. Grishin leg. (NVG-9270); and Texas: 1♀ Marion Co., Caddo Lake region, along SH43, GPS 32.7957, −94.1755, 20- Jun-2015, N. V. Grishin leg. (NVG-3694); 1♂ Wise Co., LBJ National Grassland, Cottonwood Lake, GPS 33.3828, −97.5719, 19-Jul-2015, N. V. Grishin leg. (NVG-4182); 1♀ Hardin Co, 4.4 mi SW Kountze, along FM 770, GPS 30.3389, −94.3678, 7-Jun-2015, N. V. Grishin leg. (NVG-3506); Travis Co., Barton Creek Greenbelt, Camp Craft Road entrance, 28-Mar-2016, W. R. Dempwolf, leg.: 1♂ (NVG-22088H04, WRD 9243) and 1♀ (NVG-22088H05, WRD 9244); and 1♂ Blanco Co., USH281 ca. 1 mi N of USH290, 3-Oct-2015, W. R. Dempwolf, leg. (NVG-22088H03, WRD 3649).

Type locality. USA: North Carolina, Mecklenburg Co., Charlotte, W. Arrowood Rd. and Green Ridge Dr. near Sugar Creek .

Etymology. In Latin, orientalis means eastern. This way, the eastern Eastern Tailed Blue gets its eastern name. The name is an adjective.

Distribution. In the eastern half of the USA, southwards to central Texas and Florida.