Microtia elva bogotana, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, Taxonomic advances driven by the genomic analysis of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (7), pp. 1-43 : 7-8

Microtia elva bogotana Grishin, new subspecies

http://zoobank.org/ 89EA04FE-2674-42EA-9B2E-AE4752B17097

( Figs. 4 part, 5)

Definition and diagnosis. Genomic analysis of Microtia elva H. Bates, 1864 (type locality in Guatemala and Nicaragua) reveals that while more boldly patterned southern populations included in the subspecies Microtia elva horni Rebel, 1906 (type locality in Mexico: Oaxaca) ( Fig. 4 labeled in cyan) are not phylogenetically separated from the nominotypical subspecies ( Fig. 4 labeled in blue), the two specimens from Bogota in Colombia, which corresponds to the southernmost known record of the species, are genetically differentiated from the rest ( Fig. 4 magenta) and we consider them to represent a new subspecies of M. elva . This new subspecies differs from its relatives by dark legs, brighter orange color of bands and spots, wider forewing band, and larger and rounder inner forewing margin spot than in the nominate subspecies, but narrower discal band on the hindwing, especially beneath. A combination of the following DNA characters is diagnostic in the nuclear genome: hm2012473-RA.1:G201A, hm2012473-RA. 1:C210T, hm2011393-RA.1:T1506A, hm2011393-RA.1:A1725G, hm2015159-RA.5:C1024A and in COI barcode: T13T, G38G, A43A, T589C, T513T.

Barcode sequence of the holotype. Sample NVG-22117B06, GenBank PP254243, 658 base pairs: TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGACTTTTAATTCGAACTGAATTAGGAAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGATTACTACCTCCATCACTTATATTATTAATTTCTAGTAGTATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCCTCCAATATTGC TCATAGCGGATCATCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATCTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGTATTAATAATATATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATCACAGCTCTTTTATTATTATTATCATTACCAGTATTAGCAGGAGCTATTACCATACTTTTAACTGACCGAAATATTAATACAT CATTTTTTGACCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the collection of Museum für Naturkunde, Berlin, Germany [ MFNB], illustrated in Fig. 5, bears four labels, 1 st handwritten, others printed: three white [13 | VII], [Bogota | Nolcken], [DNA sample ID: | NVG-22117B06 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Microtia elva | bogotana Grishin] . Paratype: 1♀ the same locality, collector, and repository as the holotype (NVG-22117B07, bears an additional erroneous handwritten label “ Brasilien ”) .

Type locality. Colombia: Bogota .

Etymology. The name refers to the type locality.

Distribution. Colombia.

Comments. The lack of separation of subspecies into clades in the genomic trees (e.g., M. elva horni vs. M. elva horni ) does not mean that the subspecies are not valid, it only means that this phylogenetic method does not separate them. Such a situation can arise due to limited genetic differentiation and/or extensive gene flow. Population analysis is needed to define groups of populations that are best treated as subspecies if phylogenetic tree methods fail. Finally, further research and additional specimens are needed to investigate whether M. elva bogotana ssp. n. might be a species-level taxon.