Boloria astarte alaskia, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, Taxonomic advances driven by the genomic analysis of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (7), pp. 1-43 : 8-10

Boloria astarte alaskia Grishin, new subspecies

http://zoobank.org/ 2B44E674-0784-4977-ADE5-A8AD69E30582 ( Figs. 6 part, 7a)

Definition and diagnosis. Genomic analysis that includes the holotype of Boloria astarte tschukotkensis (Wyatt, 1961) (type locality in Russia: Chukotka Mts., sequenced as NVG-20095A04) reveals that Boloria astarte (E. Doubleday, [1847]) (type locality in Canada: Alberta) partitions into four, not three, distinct clades. Three clades correspond to subspecies of B. astarte : the nominate ( Fig 6 green), Boloria astarte distincta (A. Gibson, 1920) (type locality in Canada: Yukon, Harrington Creek) ( Fig 6 blue), and B. astarte tschukotkensis ( Fig 6 purple). The fourth clade ( Fig 6 red) comprises populations from Alaska, USA, that are currently called B. astarte tschukotkensis but, as our analysis shows, are genetically distinct from it. While forming a prominent clade in the nuclear genome tree ( Fig. 6a), these populations from Alaska exhibit only 0.3% (2 bp) difference in the COI barcode from the nominate B. astarte . Therefore, this Alaskan clade represents a new subspecies. This new subspecies differs from others by its generally smaller size, less extensive white overscaling beneath, e.g., near the outer margin of the ventral hindwing, the submarginal row of spots is not covered with white, and white scaling is mostly restricted to the belt between the marginal and submarginal row of spots. The submarginal spots are rounder on the ventral side, not triangular as in B. astarte distincta ( Fig. 6a vs. b). A notable difference is that the submarginal spots on the ventral forewing point outside (towards the margin) with their sharper ends in the new subspecies but inside (towards the wing base) in B. astarte distincta . The new subspecies differs from B. astarte tschukotkensis by better defined submarginal spots and weaker expressed and narrower dark framing in the discal area of ventral hindwing. A combination of the following DNA characters in the nuclear genome is diagnostic: hm2009446-RA.6:T96A, hm2010326-RA.1:G46A, hm2002793-RA.5:C72T, hm2010724-RA.2:T198A, hm2010724-RA.2:C255A but COI barcodes do not identify it consistently.

Barcode sequence of the holotype. Sample NVG-21068B11, GenBank PP254244, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTCTTAGTTTACTAATTCGAACTGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCATTTCCCCGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCTTTAATTTTACTTATTTCAAGTAGAATTGTCGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC TCATAGAGGAGCTTCAGTAGACCTAGCAATTTTTTCTCTACATTTAGCTGGTATTTCCTCCATCCTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGGATTAATAATATATCT TTTGATCAAATACCATTATTTGTATGAGCTGTAGGTATTACAGCTTTATTACTTTTATTATCTTTACCAGTTTTAGCAGGAGCTATTACAATACTTTTAACTGATCGTAATTTAAATACTT CATTTTTTGATCCTGCAGGAGGAGGAGATCCCATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [ MGCL], illustrated in Fig. 7, bears four labels, 1 st handwritten, others printed: three white [Omilak, Darby Mtns | Alaska | June 24, 1986 | Collectors | J + L Troubridge], [J. & F. Preston Coll. | Allyn Museum | Acc. 1989-21], [DNA sample ID: | NVG-21068B11 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Boloria astarte | alaskia Grishin ]. Paratypes: 2♂♂ and 2♀♀: from USA: Alaska: 1♂ Seward Peninsula, Kougarok Road, mile 48, Big Creek, elevation 1100 ft, 16-Jul-1979, Joseph D. Zeligs leg. (NVG-22039A05, fig. James Scott book, from James A. Scott collection); 1♀ Brooks Range, Chandalar Shelf Ridge, W of Dalton Hwy mile 237.5, 24-25-Jun-1999, Malcolm G. Douglas leg. (NVG-21068C01) [ MGCL]; North Slope Borough, Dalton Highway, W. R. Dempwolf leg.: 1♂ N of Atigun Pass, elevation 2784', GPS 68.1558, −149.4361, 12-Jul- 2021 (NVG-22059C05, WRD 20230) and 1♀ near Atigun Pass, elevation 3700', GPS 68.1397, −149.4439, 11-Jul-2021 (NVG-22059C06, WRD 20229).

Etymology. The name refers to the state of the type locality.

Distribution. From the Seward Peninsula to the Brooks Range in Alaska, USA.