Ithomiola (Ithomiola) coladoris, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, Taxonomic advances driven by the genomic analysis of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (7), pp. 1-43 : 11-13

Ithomiola (Ithomiola) coladoris Grishin, new species

http://zoobank.org/ 6C7200DE-F7A0-4DC0-A72D-317ACE584322 ( Figs. 9 part, 10b)

Definition and diagnosis. Genome-based phylogeny of Ithomiola (Ithomiola) C. Felder & R. Felder, 1865 (type species Ithomiola floralis C. Felder & R. Felder, 1865 ) reveals that a specimen from Panama ( Fig. 9 magenta) identified as Ithomiola cribralis (Stichel, 1915) (type locality in Ecuador) ( Fig. 9 green) due to phenotypic similarities, is genetically differentiated from it at the species level ( Fig. 9), e.g., their COI barcodes differ by 2.3% (15 bp), and therefore represents a new species. This species is most similar to its closest relative, I. cribralis , and differs from it by larger forewing white spots in both sexes (compare within each sex), larger hindwing discal white patch, and blue scaling extending farther from the tornus along the hindwing outer margin. For additional illustrations, see Figs. 62A (holotype), 62B (paratype), and 146 (male genitalia of the holotype) in Hall (2005), who has not illustrated true I. cribralis showing this species instead. Because the phenotypic variation of this species has not been extensively explored, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne10210.1.1:A505C, cne10210.1.1:A507G, cne804.5.4:A99G, cne41. 6.2:T747C, cne41.6.2:A777G, cne9763.1.7:C72C (not T), cne5785.2.3:C93C (not T), cne191.3.2:T87T (not C), cne10809.1.1:T36T (not C), cne6006.2.2:T132T (not A) and in COI barcode: T40A, T184C, T376C, A403G, T500C, T653C.

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGTATAGAATTAGGTATACCTGGATCTTTAATTGGTGATGATCAAATTTATAACACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGCTTTGGAAATTGACTTGTTCCTTTAATGTTAGGAGCTCCAGATATAGCTTTTCCTCGTA TAAATAACATAAGATTTTGACTTTTACCTCCTTCATTAATTCTGCTTATTTCAAGAAGAATTGTTGAAAATGGTGCAGGTACTGGATGAACTGTTTACCCCCCTTTATCTTCTAATATTGC ACATGGAGGATCCTCTGTTGACTTAGCAATTTTTTCATTGCATTTAGCAGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTCTATTTGTTTGATCTGTAGGAATTACAGCATTACTATTACTTTTATCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACAGATCGAAATTTAAATACTT CATTTTTTGATCCTGCTGGAGGAGGTGATCCTATTCTTTATCAACATCTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History , Washington, DC, USA [ USNM], illustrated in Fig. 10b, bears five printed (text in italics handwritten) labels: four white [ PANAMA: PANAMA | Cerro Jefe 900 m. | IV-22 .19 77 | G. B. Small], [Genitalia Dissection | #1999 - 62 | Donald J. Harvey], [DNA sample ID: | NVG-18122D02 | c/o Nick V. Grishin ], [USNMENT | {QR Code} | 01532041], and one red [HOLOTYPE ♂ | Ithomiola (Ithomiola) | coladoris Grishin] . Paratype: 1♀ the same data as the holotype, illustrated by Hall (2005) as Fig. 62B (not sequenced) .

Type locality. Panama: Panama, Cerro Jefe , elevation 900 m.

Etymology. In Latin, cribrum means sieve or strainer and is a possible root of the name cribralis , given by Stichel to the sister of the new species, likely for the pattern of small white spots resembling small holes of a sieve. The new species has bigger spots, more similar to holes in colander, or colador in Spanish, hence the name, which is an adjective.

Distribution. Known only from Panama.