Lasaia pallida, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, Taxonomic advances driven by the genomic analysis of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (7), pp. 1-43 : 14-16

Lasaia pallida Grishin, new species

http://zoobank.org/ 846287C6-261D-4A8E-AF3D-2AC49CA0895C

( Figs. 11 part, 12)

Definition and diagnosis. Genomic analysis of Lasaia H. Bates, 1868 (type species Papilio meris Stoll, 1781 ) reveals a clade of three specimens from Colombia and Venezuela ( Fig. 11 red) sister to both L. peninsularis Clench, 1972 (type locality in Mexico: Yucatan) and L. sula Staudinger, 1888 (type locality in Honduras) in the nuclear genome tree ( Fig. 11 cyan and purple). This clade consists of paler in appearance specimens not associated with any available name. In the COI barcodes, specimens from this clade differ by 4.7% (31 bp) from L. pseudomeris Clench, 1972 (type locality in Bolivia) and by 5.6% (37 bp) from L. sula . Therefore, this clade represents a new species. This new species differs from its relatives by a combination of the following characters: generally paler and greener, with less developed black spotting above mostly constrained to the forewing apex and anterior portion, paler areas towards costa on the dorsal side of both wings, two prominent subapical pale spots, hindwing with brown spots weakly developed, restricted to the area near the costa and in some specimens the base; ventrally darker than many other species, hindwing with paler basal third, most prominent nearly white area anterior of discal cell, but towards the outer margin it is only somewhat paler than the discal area, without contrasting pale patches in the submarginal area. The entire type series is illustrated ( Fig. 12) because the three specimens differ in their appearance, giving a range of phenotypic variation in this species. Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome:

and in COI barcode: T103C, A295T, T478C, T586G, A643G.

Barcode sequence of the holotype. Sample NVG-23014A03, GenBank PP254249, 658 base pairs:

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCTTTAAGTTTATTAATTCGTATAGAATTAGGTATGCCAGGATCATTAATTGGTGACGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCTCCATCTTTATTTCTACTAATTTCTAGAAGTATTGTAGAAAACGGAGCAGGAACTGGATGAACAGTTTACCCCCCACTGTCTTCTAATATTGC TCATGGAGGATCTTCTGTAGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAACTTATCC TTTGATCAAATACCACTTTTTGTCTGATCAGTTGGTATTACTGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACGGATCGTAATTTAAATACAT CTTTTTTTGATCCTGCAGGAGGAGGTGATCCAATTCTGTATCAACATTTATTC

Type material. Holotype: ♂ deposited in the Zoologische Staatssammlung München, Germany [ ZSMC], illustrated in Fig. 12a, bears four labels, 2 nd handwritten, others printed: three white [ Venezuela | Maracay | ges.P.Vogl], [ Lasaia | meris | Stoll], [DNA sample ID: | NVG-23014A03 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Lasaia pallida | Grishin ]. Paratypes: 2♂♂: the same data as the holotype, 1936 (NVG-23014A04) and Colombia, Karsten leg. (NVG-22112G05) [ MFNB].

Type locality. Venezuela: Maracay .

Etymology. In Latin, pallidus means pale or pallid. The name refers to the paler appearance of this species, particularly towards the costa on both wings above and the basal third of the hindwing beneath, and is a feminine adjective.

Distribution. Colombia and Venezuela.

Comments. Although we have not yet sequenced Lasaia meris (Stoll, 1781) (type locality in Suriname) and Lasaia maritima J. Hall & Lamas, 2001 (type locality in Peru: Piura), Lasaia pallida sp. n. is a species distinct from them. From the original illustration, L. meris is a strongly patterned species with well-developed pale submarginal areas on the hindwing ( Stoll 1780 –1782), and thus differs from leastpatterned Lasaia pallida sp. n. Querying BOLD database ( Ratnasingham and Hebert 2007) with COI barcodes of our sequenced specimens reveals that L. maritima is a species closely related to Lasaia agesilas (Latreille, [1809]) (type locality in Peru), similarly to Lasaia aerugo Clench, 1972 (type locality in Peru: Cajamarca), and thus different from Lasaia pallida sp. n.