Hedone miracla, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, Taxonomic advances driven by the genomic analysis of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (7), pp. 1-43 : 35-37

Hedone miracla Grishin, new species

http://zoobank.org/ 81924866-9D81-4CAF-AA05-4BCC49DAF282

( Figs. 31 part, 32)

Definition and diagnosis. Genomic analysis of Hedone Scudder, 1872 (type species Hesperia brettus Boisduval & Le Conte, [1837] , a junior subjective synonym of Thymelicus vibex Geyer, 1832 ) reveals that a female collected north of Lima in Peru is sister to Hedone mira Grishin & Lamas, 2022 (type locality in Peru: Apurímac) but is genetically differentiated from it at the species level ( Fig. 31), e.g., their COI barcodes differ by 2.4% (16 bp). Therefore, this female represents a new species. This new species differs from other Hedone species (except H. mira ) by rusty-colored ventral hindwing with a yellowish broken discal band and only slightly scalloped dark outer border of forewing, and differs from H. mira by redder and broader (but not as broad and continuous as in Hedone bittiae (Lindsey, 1925) , type locality in Peru) discal band on ventral hindwing, more diffuse marginal brown on dorsal hindwing blending with orange ground color, smaller forewing subapical spots, and submarginal spots more offset towards the forewing margin. Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly103.11.2:C760T, aly103.11.2:A1569G, aly159.18.1:T114A, aly159.18.1:C198T, aly499.1.3:G42A, aly1487.2.21:G57G (not A), aly 1487.2.21:C60C (not A), aly577.49.5:A174A (not G), aly331.3.6:C165C (not T), aly569.1.2:C109C (not T) and in COI barcode: T124C, T284C, T343A, T532A, T596C.

Barcode sequence of the holotype. Sample NVG-22102C03, GenBank PP254260, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAA TAAATAACATAAGATTTTGAATATTACCTCCTTCACTAACACTATTAATTTCAAGAAGAATTGTAGAAAATGGTGTAGGAACAGGTTGAACAGTTTATCCACCTTTATCTTCTAATATTGC TCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATTAAAAATTTATCT TTTGATCAAATACCTTTATTTGTATGATCTGTTGGAATTACAGCTCTATTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACAGATCGAAATCTAAATACTT CTTTTTTTGATCCAGCTGGAGGAGGAGATCCAATCTTATATCAACATTTATTT

Type material. Holotype: ♀ currently deposited in the California Academy of Sciences, San Francisco, CA, USA [ CAS], illustrated in Fig. 32, bears seven labels, 3 rd and 4 th handwritten (below, text in italics handwritten) and others printed: six white [Chancay, | PERU.III-15-51| River valley], [Ross and | Michelbacher | Collectors], [♀ 6113 | P. vibex ? | C. D. MACNEILL' 93], [ Polites vibex | bittiae ? LINDSEY | Det. C.D. MacNeill '93], [DNA sample ID: | NVG-22102C03 | c/o Nick V. Grishin ], [{QR Code} CASENT | 8566975], and one red [HOLOTYPE ♀ | Hedone miracla | Grishin ].

Type locality. Peru: Lima Department, ~ 80 km north of Lima, Chancay River valley .

Etymology. The name is formed from the sister species, H. mira , and is a noun in apposition.

Distribution. Currently known only from the holotype collected in coastal Peru north of Lima.