Dna extraction, , PCR

Asgari, Mohsen, Mokhtari, Somayeh, Eskandari, Ali & Peña-Santiago, Reyes, 2025, Description and molecular characterisation of Aquatides caelibis sp. n. (Dorylaimida: Nygolaimidae) from Iran, with updated taxonomy of the genus and new insights into its evolutionary relationships, Journal of Natural History 59 (25 - 28), pp. 1877-1893 : 1878

DNA extraction, PCR and sequencing

Following morphological confirmation, some fresh individuals were selected for DNA extraction . DNA was extracted using the modified Chelex method ( Rashidifard et al. 2019). Each nematode was transferred to an Eppendorf tube containing 20 μL of nuclease-free water, 25 μL Chelex (5%, w/v) and 5 μL of proteinase K (20 mg /mL). The microtubes were incubated at 56°C for 2 h, then at 95°C for 10 min, and the solutions obtained were used as DNA templates. Next, 5 μL of each extracted DNA was added to the polymerase chain reaction (PCR) mixture in a 0.2 mL Eppendorf tube containing:15 μL 2X Master mix (Ampliqon, Odense, Denmark), 1 μL of each primer (10 pmol/μL) and 8 μL ddH 2 O, to a final volume of 30 μL. The D2–D3 region of 28S rDNA (LSU) were amplified using forward D2A (5’– ACAAGTACCGTGAGGGAAAGTTG–3’) and reverse D3B (5’–TCGGAAGGAACCAGCTACTA–3’) primers ( Nunn 1992; De Ley et al. 1999). PCR reactions were carried out in a DNA thermal cycler (Hybaid, Ashford, Middlesex, UK). The PCR cycle conditions were as follows: initial denaturation cycle at 94°C for 15 min, followed by 35 cycles of denaturation at 94°C for 45s; an annealing cycle at 56°C for 45s; an extension cycle at 72°C for 1 min; and finally an elongation cycle at 72°C for 5 min. After DNA amplification, the quality of PCR was checked by electrophoresis of 4 μL of the PCR reactions in 1% agarose gel containing SYBR Green I. Products were visualised and photographed under ultraviolet light. The length and concentration of each PCR product were measured by comparison with a low DNA mass ladder (Invitrogen, Carlsbad, CA). The PCR products were purified and sequenced directly for both strands using the same primers with an ABI 3730XL sequencer (Bioneer, Seoul, South Korea). The newly obtained sequences of the D2–D3 region of 28S rDNA were submitted to the GenBank database.