Jemadia demarmelsi Orellana, [2010]
publication ID |
https://doi.org/10.11646/zootaxa.5319.4.7 |
publication LSID |
lsid:zoobank.org:pub:AE993A70-D5C2-46E3-A570-40EF0DB7ECC2 |
DOI |
https://doi.org/10.5281/zenodo.8211464 |
persistent identifier |
https://treatment.plazi.org/id/AF07C417-FFAC-2D5A-15F7-FB0E9023F840 |
treatment provided by |
Plazi |
scientific name |
Jemadia demarmelsi Orellana, [2010] |
status |
|
Jemadia demarmelsi Orellana, [2010] View in CoL confirmed as a species-level taxon
Genomic sequencing of the holotype of Jemadia demarmelsi Orellana, [2010] (type locality in Venezuela: Bolívar) in the MIZA collection reveals that in genomic trees it is placed in its own clade of similar prominence to J. pseudognetus and J. hospita ( Fig. 1 View FIGURE 1 ), and its COI barcode differs by 4.3% (28 bp) and 3.0% (20 bp) from these species, respectively. Therefore, we confirm the close relationship of J. demarmelsi with these two species and its distinctness from them at the species level. Moreover, sequencing of a female specimen from Bolívar, Venezuela (NVG-20054H05, Fig. 2 View FIGURE 2 ) with very large forewing hyaline spots that are similar to J. demarmelsi holotype establishes it as a female of J. demarmelsi due to genetic similarities ( Fig. 1 View FIGURE 1 , COI barcodes 100% identical). Interestingly, the coloration of the bands in the female is cyan-blue, not purplish, as in the male holotype. The COI barcode sequence of the holotype of J. demarmelsi , sample NVG-22029C06, GenBank accession OR178493, 658 base pairs is:
AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACATCTTTAAGATTATTAATTCGAACTGAGCTAGGAATTCCAGGATCTTTAATCGGA GATGATCAAATCTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAG TACCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGATTACTACCCCCTTCTTTGACCCTGCTTATTTCAAGCAG TATTGTAGAAAATGGTGCTGGTACTGGTTGAACTGTTTATCCCCCTCTTTCTTCTAATATTGCCCACCAAGGAGCCTCTGTAGATATAGCTATTTTTTCT TTACATTTAGCAGGAATTTCCTCAATTTTAGGAGCTATCAACTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCAT TATTTGTTTGAGCAGTTGGAATTACAGCATTACTTTTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTAACAGATCGAAATATTAA TACCTCTTTCTTTGACCCTGCTGGAGGTGGGGATCCTATTTTATATCAACATTTATTT
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |