Bowie ninhbinh S. Li & Yao, 2022
|
publication ID |
https://dx.doi.org/10.3897/BDJ.10.e96003 |
|
publication LSID |
lsid:zoobank.org:pub:2A9D4A67-DC00-40DC-9745-BF531D767F55 |
|
persistent identifier |
https://treatment.plazi.org/id/830F2587-709C-5BBB-B737-FDE9E22C3211 |
|
treatment provided by |
|
|
scientific name |
Bowie ninhbinh S. Li & Yao |
| status |
sp. n. |
Bowie ninhbinh S. Li & Yao sp. n.
Materials
Type status: Holotype. Occurrence: recordedBy: Z. Chen; individualCount: 1; sex: male; lifeStage: adult; Taxon: order: Araneae; family: Ctenidae ; genus: Bowie ; Location : country: Vietnam; stateProvince: Ninh Binh; verbatimLocality: Cuc Phuong National Park ; verbatimElevation: 158 m a.s.l.; verbatimLatitude: 20°15.006'N; verbatimLongitude: 105°42.895'E; Event: samplingProtocol: Collected by hand in leaf litter; year: 2015; month: 8; day: 19; Record Level: institutionCode: IZCAS-Ar 43542 Type status: Paratype. Occurrence: recordedBy: Z. Chen; individualCount: 1; sex: male; lifeStage: adult; Taxon: order: Araneae; family: Ctenidae ; genus: Bowie ; Location : country: Vietnam; stateProvince: Ninh Binh; verbatimLocality: Cuc Phuong National Park ; verbatimElevation: 158 m a.s.l.; verbatimLatitude: 20°15.006'N; verbatimLongitude: 105°42.895'E; Event: samplingProtocol: Collected by hand in leaf litter; year: 2015; month: 8; day: 20; Record Level: institutionCode: IZCAS-Ar 43543 GoogleMaps GoogleMaps GoogleMaps GoogleMaps
Description
Male (IZCAS-Ar 43542): PL 7.6, PW 5.9, AW 3.0, OL 5.8, OW 3.9. Eye diameters and interdistances: AME 0.26, ALE 0.19, PME 0.38, PLE 0.30, AME-AME 0.19, AME-ALE 0.29, PME-PME 0.22, PME-PLE 0.43, AME-PME 0.18, ALE-PLE 0.23, clypeus AME 0.11, clypeus ALE 0.55. Palp and leg measurements: palp 7.8 (2.7, 1.2, 1.3, -, 2.6), I 21.3 (5.6, 3.0, 5.8, 4.9, 2.0), II 19.6 (5.3, 2.7, 5.1, 4.7, 1.8), III 15.9 (4.3, 2.5, 3.4, 4.1, 1.6), IV 23.1 (5.9, 2.5, 5.7, 7.0, 2.0). Leg formula 4123. Spination of palp and legs: palp 151, 100, 101; femora I p021, d111, r112, II p112, d111, r112, III p212, d111, r112, IV p112, d111, r012; patellae I-IV 101; tibiae I p110, d111, r210, v22222, II p110, d111, r110, v22222, III p11, d200, r11, v222, IV p11, d111, r11, v222; metatarsi I-III p112, d010, r112, v222, IV p112, d010, r112, v2222. Chelicerae with 3 promarginal, 4 retromarginal teeth and with elongated patch of 19 tiny denticles along entire cheliceral furrow. Retromargin of chelicerae close to fang base with 6 bristles. Ventral tarsi and metatarsi I-II with sparse scopula. Right leg claws I-III with 2 and IV with 3 secondary teeth. Position of tarsal organ: I 1.27, II 1.28, III 1.06, IV 1.36.
Palp (Fig. 17 View Figure 17 a-c). RTA arising from tibia subdistally, stout and distally bifurcated. Cymbium tip slightly conical, with retro-proximally outgrowth. Embolus (Fig. 28 b) arising at 7.30 o’clock position, its tip wide and blunt, situated in distal half of tegulum. Conductor arising at 12 o’clock position. Tegular apophysis arising subcentrally from tegulum, nearly round.
Colour (Fig. 18 View Figure 18 a and b). Reddish-brown to yellowish with dark patterns. Dorsal prosoma with characteristic lighter median band, widened behind eyes and with some white hairs, distinctly marked fovea and indistinct radial markings. Sternum and ventral coxae yellowish, labium brown and gnathocoxae brown with dark patterns. Chelicerae reddish-brown with longitudinal lines. Legs reddish brown-yellowish. Dorsal opisthosoma yellowish with black patches. Lateral opisthosoma yellowish with darker spots. Ventral opisthosoma yellowish with dark patterns; epiandrium and muscle sigilla light. Spinnerets and anal tubercle light.
Female
Unknown.
Variation: Paratype male (IZCAS-Ar 43543): PL 7.4, OL 5.7.
Diagnosis
Medium-sized Ctenidae (total length male 13.1-13.4). The new species is assigned to the robustus -species group with the characteristics of stout tegular apophysis, simple stout embolus with broad base, presence of retro-proximal cymbial outgrowth and RTA arising subdistally from palpal tibia. It resembles B. dodo Jäger, 2022 (see Jäger 2022: figs 241-243 and 267-268) by having similar conductor, broad embolus and retro-proximal cymbial outgrowth (Fig. 17 View Figure 17 a-c and Fig. 28 b), but can be distinguished by the tegular apophysis nearly round and without concave (Fig. 17 View Figure 17 b, tegular apophysis with distinct concave on retrolateral side in B. dodo ) and by the RTA distally bifurcated (Fig. 17 View Figure 17 b, RTA having no bifurcation in B. dodo ).
Etymology
The specific name refers to the type locality and is a noun in apposition.
Distribution
Vietnam (Ninh Binh, type locality; Fig. 1 View Figure 1 ).
DNA Barcode
Male (IZCAS-Ar 43542):
TACTTGGATCTTGGGCTGCTATGGCAGGGACAGCTATAAGAGTATTAATTCGGATGGAATTAGGCCATTCTGGGAGATTGTTAGGTGATGATCATTTATACAATGTAATTGTTACTGCACATGCTTTTGTAATGATTTTTTTTATAGTAATGCCTATTTTAATTGGGGGTTTTGGAAATTGGTTAGTACCTTTGATATTAGGGGCTCCTGATATATCTTTTCCTCGAATAAATAATTTGTCTTTTTGGTTACTTCCTCCTTCGTTATTTTTATTATTTATATCTTCAATAGTTGAGATAGGAGTTGGAGCTGGATGAACGGTATATCCTCCTTTAGCTTCTAGTATTGGTCATATAGGGAGATCTATAGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCTTCTTCTATTATAGGAGCGGTAAATTTTATTTCTACGATTATTAATATGCGTTTGTATGGGATGACTATAGAGAAAGTACCTTTATTTGTGTGATCTGTTTTAATTACTGCGGTATTGTTATTATTGTCTTTACCTGTTTTAGCAGGTGCTATTACTATATTGTTAACTGATCGAAATTTTAATACTTCTTTTTTTGATCCGGCTGGGGGTGGTGATCCTGTTTTGTTTCAACATTTATTTTGATTTTTTG (GenBank accession number OP572110).
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
