Haplaxius crudus, VanDuzee, VanDuzee

Komondy, Lidia, Huguet-Tapia, Jose, Ascunce, Marina S., Helmick, Ericka E., Goss, Erica M. & Bahder, Brian W., 2021, The Complete Mitochondrial Genome of the American Palm Cixiid, Haplaxius crudus (Hemiptera: Cixiidae), Psyche: A Journal of Entomology (6625462) 2021, pp. 1-8 : 2-4

3. Results

3.1. Genome Size, Organization, and Structure. Th e assembled contig demonstrated that the mitochondrial genome of H. crudus is a circular DNA molecule 15,848bp in length. Th e mitochondrial genome includes 37 genes, 13 PCGs, 22 tRNA genes, and 2 rRNA ribosomal genes ( Figure 2 , Table 2 ). Th e new sequence was submitted to GenBank under the accession number ( MW057863 ). Th e major strand (α strand) carries most of the genes (8 PCGs and 14 tRNAs), while the remaining genes are encoded on the minor strand (β strand). Th e AT-rich regions of the mitogenome range from 14,720 to 15,848bp with the location between rrnL and tRNA-Ile ( Figure 2 ). Th e nucleotide composition of the H. crudus mitochondrial DNA is A � 7,097 (44.8%), T � 5,279 (33.3%), G � 1,341 (8.5%), and C � 2,128 (13.4%) of 15,845 nucleotides present. Th e genome organization generally follows the standard order of the ancestral insect mitochondrial genome plan ( Figure 3 ).

3.2. Protein-Coding Genes. Th e mitochondrial DNA of H. crudus contains the full set of PCGs usually present in animal mitochondrial DNA. PCGs are arranged along the genome according to the standard order of insects ( Figure 3 ). Th e putative start codons of PCGs are those previously known for animal mitochondrial DNA, i.e., ATG, ATT, ATA, ATC, GTG, TTG, and GTT ( Table 2 ) [ 28]. Th e common start codon ATG could be assigned to most of the protein-coding sequences, with few exceptions. Two protein-coding regions, ATP6/ATP8 and ND4/ND4L, overlap and are translated from the same cistronic mRNAs. In addition to the control region, we observed 18 noncodingregionsrangingfrom1to1,210bp( Figure2 , Table2 ). Th e noncoding control region in the H. crudus mitochondrial genome extends 1,129bp and is located between the final tRNA (tRNA-Val) and the Ile-Gln-Met tRNA cluster. Th ere are many unique TA-dinucleotides and TTA-trinucleotide repeats within the H. crudus mitochondrialgenomesequencethataresimilarto microsatellite sequence divergence. Th e repeating 21nt motif is AAAATGTCAAAAATTTGGACT 31.

3.3. Phylogenetic Analysis. Th e phylogenetic analysis performed show that Haplaxius crudus resolved with Nilaparvata lugens ( Delphacidae ) with strong bootstrap support (100) ( Figure 4 ). Th ere was also strong support (100) for Aphis aurantii (aphids) resolving near both H. crudus and N. lugens . In general, there is strong support (100) for each clade that comprises an order of insect: the Hemiptera clade that includes H. crudus , N. lugens , A. aurantii , Dolycoris baccarum , and Magicicada tredecassini , the Coleoptera clade that includes Sitophilus oryzae and Chauliognathus opacus , the Odonata clade that includes Nannophya pygmaea , and the Diptera clade that includes Drosophila melanogaster ( Figure 4 ). Based on the pairwise comparison, N. lugens also shows the highest level of sequence homology among the analyzed taxa, differing from H. crudus by 28.3% ( Table 3 ).

All other taxa differ from H. crudus by at least 30.7% ( Table 3 ).

Figures

FIGURE 2: Map of the mitochondrial genome of Haplaxius crudus; outer circle � positive strand, inner circle � negative strand, blue � tRNAs, orange � protein-coding gene, green � rRNA, and gray � control region.

FIGURE 3: Linear map of the putative ancestral insect mitochondrial genome (top) compared to Haplaxius crudus and other insect species; orange � deviation from ancestral genome.

FIGURE 4: Maximum likelihood phylogenetic reconstruction at 1,000 bootstrap replicates of ten insect species based on the mitochondrial genome using the Tamura–Nei model.