Dna extraction, , PCR

Lee, S. Y. & Mohamed, R., 2016, Rediscovery of Aquilaria rostrata (Thymelaeaceae), a species thought to be extinct, and notes on Aquilaria conservation in Peninsular Malaysia, Blumea 61 (1), pp. 13-19 : 14

DNA extraction, PCR and sequencing

For fresh leaves, genomic DNA was extracted from a total of 1 g fresh tissue using the DNeasy® Plant Mini Kit (Qiagen, USA), according to the manufacturer’s protocol. For herbarium specimens, genomic DNA was extracted from 20 mg of the dried leaf tissue using the same extract kit based on a modified and optimized protocol suggested by Costa & Roberts (2014). The quantity and quality were determined using NanoPho- tometerTM (IMPLEN, Germany). For PCR amplification, the nrITS region was amplified using the forward primer, ITS92, 5’AAGGTTTCCGTAGGTGAAC3’ and reverse primer, ITS75, 5’TATGCTTAAACTCAGCGGG3’ ( Baldwin 1992); while the trn L- trn F region was amplified using the forward primer, e, 5’GGTTCAAGTCCCTCTATCCC3’ and reverse primer, f, 5’ATTTGAACTGGTGACACGAG3’ ( Taberlet et al. 1991). The final reaction volume was 25 µL, containing 12.5 µL of 2 × PCRBIO Taq Mix Red (PCRBiosystems, UK), 0.4 µM for both forward and reverse primers, and 15 ng genomic DNA template. A negative control (without DNA template) was included in each run to verify the absence of contamination. PCR amplifications were conducted using MyCyclerTM Thermal Cycler (Bio-Rad, USA), programmed for 1 min at 95 °C; 40 cycles for 15 s at 95 °C, 15 s at T a and 1 min at 72 °C, with a final 3 min extension at 72 °C (T a: ITS 50°C; trn L- trn F 55 °C). Amplification products were separated using electrophoresis on 1 % agarose gels in 1 × TAE buffer, stained with ethidium bromide and photographed under UV light. PCR products were sent for direct Sanger sequencing (1st Base Laboratory Sdn. Bhd, Malaysia) using an ABI PRISM 3730xl Genetic Analyzer (Applied Biosystems, USA) from both ends.