Onespa gala (Godman, 1900)

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 159-161

Onespa gala (Godman, 1900) and Onespa brockorum Austin & A. Warren, 2009 lack overall genetic differentiation typical of species-level taxa

Genomic analysis of Onespa Steinhauser, 1974 (type species Onespa nubis Steinhauser, 1974 ) reveals a surprise ( Fig. 123). Despite phenotypic differences in both sexes, including slight differences in genitalia between Onespa brockorum Austin & A. Warren, 2009 (type locality in Mexico: Sonora) and Onespa gala (Godman, 1900) (type locality in Mexico: Veracruz, holotype sequenced as NVG-18117F05) discussed by Austin and Warren (2009) (who nevertheless note “ Onespa brockorum is very similar to O. gala ”), we failed to find DNA differences between them typical of species-level taxa. The two species do not separate phylogenetically, i.e., they do not form prominent and strongly supported clades in any of the three trees: the nuclear genome (autosomes), the Z chromosome, and the mitochondrial genome. This is the first example we encountered when a pair of species with reported genitalic differences in both sexes (albeit rather minute in our opinion) do not form separate well-supported clades in the genomic trees, and it warrants a more detailed study. It is possible that the two taxa are subspecies (in genome-scale trees, valid subspecies do not always segregate into discrete clades), or they speciated only recently and have not gained sufficient overall genetic differentiation in the presence of reproductive isolation. Here, we bring this unusual example to the attention of the research community without proposing taxonomic changes to the current classification.

http://zoobank.org/ B166E5B8-4E66-4798-9058-ABB3E797B5F7

( Figs. 123 part, 124–125)

Definition and diagnosis. In contrast to the lack of the overall genetic differentiation typical of species-level taxa between Onespa brockorum Austin & A. Warren, 2009 (type locality in Mexico: Sonora) and Onespa gala (Godman, 1900) (type locality in Mexico: Veracruz, holotype sequenced as NVG-18117F05) (see above), specimens currently within the concept of Onespa nubis Steinhauser, 1974 (type locality in El Salvador, holotype sequenced as NVG-15038F07) separate into two prominent clades: northern (from Oaxaca) and southern (from El Salvador) ( Fig. 123). Specimens between the two clades are genetically differentiated at the species level, and their Fst / Gmin /COI barcode differences are 0.24/0.017/1.1% (7 bp). Therefore, considering the lack of overall combined DNA-based distinction between O. brockorum and O. gala , the two “ nubis ” clades represent two distinct species, and the species from Oaxaca is new. This new species was previously included in the concept of O. nubis as detailed by Austin and Warren (2009). It differs from O. nubis , in both sexes, by generally smaller yellow spots (except the forewing discal cell spot that is usually larger) that are typically deeper yellow; weaker ochreous overscaling at the wing bases above (usually rather extensive in O. nubis , covering more than a posterior quarter of the hindwing from its base), e.g., in males, forewing costal cell is mostly orange above, more strongly contrasting with the darker color of the wing base due to the lack of extensive

apex and most of the hindwing. Valva is narrower and is less expanded ventrad past the middle, but with a broader distal end of the harpe. Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly276558.35.1:T118C, aly276558.35.1:G405T, aly102.22.1:T336C, aly537.21.1:T168A, aly537.21.1: G228A; and COI barcode: T82T, C266T, A400A, T500C, A577A, T595C.

Barcode sequence of the holotype. Sample NVG-18118E02, GenBank PV550055, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGACATAGCTTTCCCACGAA TAAATAATATAAGATTTTGAATATTACCCCCTTCATTAACCTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACGGTTTACCCCCCCCTATCATCTAATATTGC CCATCAAGGATCTTCTGTGGATTTAGCTATTTTTTCACTTCATTTAGCTGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATCATTAATATACGAATTAAAAATTTATCA TTTGATCAAATATCCCTATTTGTATGATCTGTAGGAATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATACTACTTACAGATCGAAACTTAAATACCT CATTTTTTGACCCAGCAGGAGGAGGAGACCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA ( CMNH), illustrated in Fig. 124, bears the following seven rectangular labels (1 st handwritten, others printed with handwritten text shown in italics), six white: [Mo Coúo (Cerro | Pelón) Mpio. Yolox | Oaxaca, MEXICO | 2150 m. | E. C. Welling], [13-IX -19 61 | Collection of | Lee D. Miller], [L. & S. Miller | Coll. C.M.Acc. | 21269 & 21733], [GENITALIA NO. | X- 28 53 | J.M.Burns 199 0], [ Buzyges nubis | ♂ (STEINHAUSER) | det. J.M.Burns 1990], [DNA sample ID: | NVG-18118E02 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Onespa nuba | Grishin ]. Paratypes: 1♂ and 3♀♀ from Mexico, Oaxaca: 1♀ NVG-17092D06 3 mi S of Telea de Castro, 6000', 18-Aug-1990, John Kemner leg., genitalia X-3070 J.M.Burns 1991 [ USNM] and others from the same locality, collector and collection as the holotype: 1♂ NVG-21107D04 12-Sep-1961, genitalia X-2855 J.M.Burns 1990 ( Fig. 125) and 2♀♀ 13- Sep-1961: NVG-18118E03, genitalia X-2854 J.M.Burns 1990 and NVG-21107D05.

Type locality. Mexico: Oaxaca, Mpio. de San Pedro Yólox, Cerro Pelón , elevation 2150 m .

Etymology. In Spanish, nube means cloud. The name of the new species has the same root as the name of its close sister, O. nubis (Latin for cloud, mist, haze), but is made shorter for its more northern relative. The name is treated as a feminine noun in apposition.

Distribution. Currently known only from Oaxaca, Mexico.