Hesperia pahaska bajanorta Grishin

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 165-166

Hesperia pahaska bajanorta Grishin , new subspecies

http://zoobank.org/ 4F174661-E48E-4C06-AB91-B2451395772F

( Figs. 126 part, 128 part, 130)

Definition and diagnosis. Genomic analysis of two specimens of Hesperia pahaska Leussler, 1938 (type locality in USA: Nebraska, Sioux Co.) from Baja California, Mexico, places them away from other populations in a clade genetically differentiated at least at the subspecies level ( Fig. 126 ); e.g., their COI barcodes differ from those of their possible sister H. pahaska hidalgo ssp. n. by 1.8% (12 bp), and, therefore, represent a new subspecies. This new subspecies keys to “ Hesperia columbia pahaska ” (M.10.5.(b)) in Evans (1955) and differs from other subspecies of H. pahaska by a combination of the following characters: paler and more uniformly colored, with paler, more diffuse, and in some specimens narrower marginal brown areas on wings above, especially on the hindwing, which is mostly orange; orange-yellow subapical and submarginal spots on the forewing weakly stand out and are smaller; and smaller white spots and yellower (not greener or redder) hue of the ventral side of wings. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly18826.15.6:T99C, aly18826.15.6:T105A, aly18826.15.6:G135A, aly128.1.3:G183A, aly128.1.3:T204C; and COI barcode: C106T, G166A, A242T, T334C, T346C.

Barcode sequence of the holotype. Sample NVG-23049G10, GenBank PV550057, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCTGGTATATTAGGAACTTCATTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTTCCACGTT TAAATAATATAAGATTTTGAATATTACCACCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGCTGAACCGTTTATCCTCCCTTATCCTCTAATATTGC TCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCACTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAAAAACTTATCT TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTACTTACTGACCGAAATTTAAATACTT CTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 130 , bears the following six rectangular labels (2 nd handwritten, others printed with handwritten text shown in italics), five white: [ MEXICO. | Baja California Norte: | 6 mi. NW Laguna Hanson, | Sierra Juarez , 22 -Jun-1980 | leg WW McGuire], [+], [Collection of | William W. McGuire], [FSCA | Florida State Collection | of Arthropods], [DNA sample ID: | NVG-23049G10 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Hesperia pahaska | bajanorta Grishin ]. Paratypes: 8♂♂ the same data as the holotype, except as indicated: 7♂♂ NVG-23049G11, NVG-23049H01, and five not sampled for DNA; and 1♂ NVG-23049G12 4 Jun-1980 .

Type locality. Mexico: Baja California Norte, 6 mi northwest of Laguna Hanson, Sierra Juarez.

Etymology. The name is formed from the name of the Mexican state with the type locality and is treated as a feminine noun in apposition.

Distribution. Mexico: Baja California Norte.

Figures

Fig. 126 (see previous page). Phylogenetic trees of Hesperia pahaska specimens constructed from protein-coding regions in: a) the nuclear genome (autosomes), based on 4,407,714 positions, b) the Z chromosome, based on 341,715 positions, and c)

Fig. 130. Hesperia pahaska bajanorta sp. n. holotype ♂ NVG-23049G10 in dorsal (left) and ventral (right) views, data in text.