Papilio priassus Linnaeus, 1758

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 39-41

Neotype designation for Papilio priassus Linnaeus, 1758

The name Papilio priassus Linnaeus, 1758 was proposed from an unstated number of specimens from “Indiis” and the original description can be translated from Latin as “wings rounded, uniformly black; the forewings with two tawny bands joined by a third smaller spot” ( Linnaeus 1758). Several years after the description, this species was re-described from specimen(s) in the collection of Queen Ludovica Ulrika ( Linnaeus 1764). Although this description is longer, it is unclear whether it applies to this species and whether the type series was among Ulrika’s specimens. Currently, and since Aurivillius (1882), two other taxa, Papilio talaus Linnaeus, 1763 (type locality in “Indiis”, described from a female) and Papilio peleus Linnaeus, 1763 (type locality in “Indiis”, described from a male) have been treated as junior subjective synonyms of P. priassus (Evans 1952; Mielke 2005).

To learn more about the taxonomic identity of this species, we searched for its syntypes among Hesperiidae holdings in all major collections that are listed in the Acknowledgments section. In particular, N.V.G. paid special attention to possible syntypes in the NHRS collection, where Clerck’s specimens are preserved, because lectotypes of P. peleus and P. talaus are specimens illustrated by Clerck ([1764]). We failed to find syntypes, which agrees with the statement in Honey and Scoble (2001) that they were lost. Not finding syntypes, we proceeded with the neotype designation. There is an exceptional need for the neotype of P. priassus to define this taxon objectively because several cryptic species are present among its relatives and its type locality is poorly defined (“Indiis”). Because type specimens of many Lepidoptera names proposed in the 18 th century were from Suriname, it seems plausible that at least part of the type series of P. priassus was from Suriname ( Honey and Scoble 2001). Therefore, we selected a Surinamese specimen, a male, which agrees with the original description and the current application of the name, as the neotype. Hereby, N.V. G. designates the specimen in MTD shown in Figs. 33a and 51b (DNA sample NVG-18095F12) as the neotype of Papilio priassus Linnaeus, 1758 .

This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of P. priassus , which is necessary because undescribed

description as “Indiis”; 75.3.2. The characters to differentiate this taxon from others are given in the original description (see the translation above), and we interpret them as: rounded and uniformly dark-brown wings, discal and subapical orange bands on the forewings, and an orange spot in between them connected to the discal band; 75.3.3. The neotype specimen is a male bearing four rectangular white labels (1st handwritten, others printed): [Surin.], [Staatl. Museum für | Tierkunde Dresden], [Stauding.& Bang-Haas | Dresden, Ankauf 1961], [DNA sample ID: | NVG-18095F12 | c/o Nick V. Grishin ] and shown in Figs. 33a and 51b; the neotype has a tear at the costal margin near the apex on each forewing and is missing the left antenna and the terminal third of the right antenna; 75.3.4. We failed to find syntypes of P. priassus among Hesperiidae holdings in all collections we visited (see Acknowledgments for their list) and therefore, taking into account similarly negative reports in literature ( Honey and Scoble 2001), believe that they were lost; 75.3.5. The neotype closely agrees with the original description and all other information published about P. priassus , as evidenced by observing the characters stated in the original description translated above in the neotype photographs in Figs. 33a and 51b; 75.3.6. The neotype is from Suriname and the original type locality given as “Indiis” is deemed to include this area, frequently referring—for non-insular New World specimens—to the Guianas in general and Suriname in particular, ( Honey and Scoble 2001); 75.3.7. The neotype is in the Museum für Tierkunde, Dresden, Germany (MTD). As a result of the neotype designation, the type locality of P. priassus becomes Suriname. The COI barcode sequence of the neotype, sample NVG-18095F12, GenBank PV549990, 658 base pairs, is: AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATCGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTGGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTCTTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCCCCTTTATCTGCTAATATTGC CCACCAAGGATCTTCTGTAGATTTAGCCATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTCTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCTTTACCCGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTTTATCAACACTTATTT