Papilio peleus Linnaeus, 1763

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 42-43

Neotype designation for Papilio peleus Linnaeus, 1763

The lectotype of Papilio peleus Linnaeus, 1763 (type locality in “Indiis”) has been designated by Aurivillius (1882) as the specimen illustrated on pl. 45, fig. 5 by Clerck ([1764]). The illustration of the lectotype shows a male with wider yellow-orange bands and more developed hyalinity along the distal margin of the discal band. To learn more about the taxonomic identity of this species, we searched for its lectotype among Hesperiidae holdings in all major collections that are listed in the Acknowledgments section. In particular, N.V.G. paid special attention to Entheus Hübner, [1819] specimens in the NHRS collection, where Clerck’s specimens are preserved, because the lectotype is a specimen illustrated by Clerck ([1764]). The lectotype was not found, which agrees with the results by Honey and Scoble (2001) who have not found type specimens of this species. Not finding the lectotype, we proceeded with the neotype designation. There is an exceptional need for the neotype of P. peleus to define this taxon objectively because several cryptic species are present among its relatives and its type locality is poorly defined (“Indiis”). For the neotype, we selected a male, which looks most similar in wing patterns to Clerck’s illustration among the specimens we examined. Clerck’s illustration shows an unusual character: the semi-hyaline orange-yellow spot in the forewing cell M 3 -CuA 1 reaches (and even overlaps with in some copies of the book) the subapical semi-hyaline band. Because this character seems to be present as an unusual aberration only, and is variably shown in different copies of the book by Clerck ([1764]), we hypothesize that it might have been an artifact of the drawing. Nevertheless, we selected a specimen with a comparatively smaller gap between the spot and the band. Hereby, N.V. G. designates the specimen in USNM shown in Figs. 33b and 51c (DNA sample NVG-23117A03) as the neotype of Papilio peleus Linnaeus, 1763 .

This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of P. peleus , which is necessary because new species are present among its close relatives, and to define the type locality that was stated in the original description as “Indiis”; 75.3.2. The characters to differentiate this taxon from others are revealed from the illustrations of its lectotype in Clerck ([1764]) and are given above, i.e., broader forewing orange bands with more extensive hyalinity along the distal margin of the discal band; 75.3.3. The neotype specimen is a male

WmSchaus], [DNA sample ID: | NVG-23117A03 | c/o Nick V. Grishin ] and shown in Figs. 33b and 51c; the neotype’s antennae overlap wings above, and the right hindwing has a thin linear scratch from the apex towards the inner margin on the ventral side; 75.3.4. We failed to find the lectotype and paralectotypes of P. peleus among Hesperiidae holdings in all collections we visited (see Acknowledgments for their list) and therefore, taking into account similarly negative reports in literature ( Honey and Scoble 2001), believe that they were lost; 75.3.5. The neotype closely agrees with the illustration of the P. peleus lectotype in nearly all characters, as evidenced by comparing the neotype shown in Figs. 33b and 51c with the illustration on pl. 45, fig. 5 in Clerck ([1764]) and the characters for this taxon listed above (75.3.2.); 75.3.6. The neotype is from French Guiana and the original type locality given as “Indiis” is deemed to cover this area because for non-insular specimens from the New World, it typically referred to the Guianas region ( Honey and Scoble 2001); 75.3.7. The neotype is in the National Museum of Natural History, Washington, DC, USA (USNM). As a result of the neotype designation, the type locality of P. peleus becomes French Guiana: Saint-Jean-du-Maroni. The COI barcode sequence of the neotype, sample NVG-23117A03, GenBank PV549991, 658 base pairs, is: AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTGGGAACTTCCTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATCGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTGGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTCTTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCCCCTTTATCTGCTAATATTGC CCACCAAGGATCTTCTGTAGATTTAGCCATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTCTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCTTTACCCGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTTTATCAACACTTATTT