Papilio peleus, Linnaeus, 1763

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 43-44

Neotype designation for Peleus aeacus Swainson, 1831

The illustration of the lectotype of Peleus aeacus Swainson, 1831 (type locality in South America, likely in the Guianas) reveals that it is a species characterized by males with forewing orange bands that are narrower, straighter at the margins, and exhibit less hyalinity. To learn more about the taxonomic identity of this species, we searched for its lectotype among Hesperiidae holdings in all major collections that are listed in the Acknowledgments section. In particular, the remainder of Swainson’s collection of insects is preserved at the University of Cambridge, UK (Anonymous 2025). We searched the collection catalogue and did not find any Entheus specimens. Not finding the lectotype, we proceeded with the neotype designation. There is an exceptional need for the neotype of P. aeacus to define this taxon objectively because several cryptic species are present among its relatives, and its type locality is not specified in the original description ( Swainson 1831). For the neotype, we selected a male, which, among the specimens we examined, looks most similar in wing patterns to the illustration of the lectotype on pl. 75, fig. 2 by Swainson (1831). Hereby, N.V. G. designates the specimen in SMF shown in Fig. 33c (DNA sample NVG-18038E04) as the neotype of Peleus aeacus Swainson, 1831 .

This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of P. aeacus , which is necessary because new species are

description; 75.3.2. The characters to differentiate this taxon from others are revealed from the original description and the illustration of its lectotype on pl. 75, fig. 2 in Swainson (1831) and are given above, i.e., narrower and straighter at the margins forewing orange bands with less hyalinity; 75.3.3. The neotype specimen is a male bearing two white labels (1st handwritten on glassine paper, 2nd printed): [ Guyana Iracoubo | Rocoucoua | III.85], [DNA sample ID: | NVG-18038E04 | c/o Nick V. Grishin ], and shown in Fig. 33c; the neotype has a chipped inner margin of the right hindwing in the middle and its right antenna points more anteriad rather than along the costal margin of the forewing; 75.3.4. We failed to find the lectotype of P. aeacus among Hesperiidae holdings in all collections we visited (see Acknowledgments for their list and see above) and catalogs we searched and believe that it was lost; 75.3.5. The neotype closely agrees with the illustration of the P. aeacus lectotype in all characters, as evidenced by comparing the neotype shown in Fig. 33c with the illustration on pl. 75, fig. 2 in Swainson (1831) and the characters for this taxon listed above (75.3.2.); 75.3.6. The neotype is from French Guiana and the original type locality “South America” agrees with it, as this phenotype is found mostly in the Amazonian region; 75.3.7. The neotype is in the Senckenberg Naturmuseum, Frankfurt, Germany (SMF). As a result of the neotype designation, the type locality of P. aeacus becomes French Guiana: Iracoubo, Rococoua. The COI barcode sequence of the neotype, sample NVG-18038E04, GenBank PV549992, 658 base pairs, is: AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTGGGAGCCCCTGACATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTCTTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTCTACCCCCCTCTATCTGCCAATATTGC CCATCAAGGATCTTCTGTAGATTTAGCCATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTCTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCTTTACCCGTATTAGCAGGCGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCCGCAGGAGGGGGGGATCCTATTCTTTATCAACACTTATTT