Entheus lina, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 52-53

publication ID

2643-4806

persistent identifier

https://treatment.plazi.org/id/4D7E87DA-4B4B-723D-FDBF-FCDDADF0FCA9

treatment provided by

Felipe

scientific name

Entheus lina
status

new species

Entheus lina Grishin, new species

http://zoobank.org/ CB2B2C09-31DE-4656-A791-D3DFFDCA9A46 ( Figs. 31 part, 34g –i, 42, 50 part, 51g)

Definition and diagnosis. Genomic analysis reveals that a female from Brazil (either Bahia or Pará) is sister to Entheus pralina Evans, 1952 , stat. nov. (type locality in Brazil: Espírito Santo) and is genetically differentiated from it at the species level ( Figs. 31, 50). e.g., their COI barcodes differ by 0.8% (5 bp), thus representing a new species. This new species keys to “ Entheus priassus telemus ” (B.10.4(b)) in Evans (1952) but differs from its relatives by a combination of the following characters in a female (no males known): the subapical hyaline forewing band is broken with the two posterior spots (submarginal doublet) offset distad from the rest (all spots are aligned in E. pralina ); the hindwing white area is larger than in relatives, reaching the inner margin, with a concave and wavy distal margin and brown scales reach into it along veins, and the boundary between the white area and brown postdiscal part of the wing is blurred towards the inner wing margin; the white spot by the forewing vein 1A+2A is slightly smaller than the spot posterior to the vein CuA 2. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly481.27.16:G72A, aly481.27.16:A78G, aly536.13.5:T48C, aly2.1.14:C45T, aly26.33.23:T94C, aly113.11.15:T112T (not C), aly 1196.8.8:C192C (not G), aly4003.1.4: C195C (not G), aly 2706.1.2:C105C (not A); and COI barcode: 499T, T500T, T530C, 622A, A628G.

AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATCGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGACATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTCTTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCCCCTTTATCTGCTAATATTGC CCACCAAGGATCTTCTGTAGATTTAGCCATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTCTATTTGTTTGAGCAGTAGGTATTACTGCACTACTTTTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCAGGAGGGGGAGATCCTATTCTTTATCAACACTTATTT

Type material. Holotype: ♀ deposited in the Museum für Naturkunde, Berlin, Germany ( MFNB), illustrated in Figs. 42 and 51g (genitalia Fig. 34g –i), bears the following seven rectangular labels (2 nd and 3 rd handwritten, others printed, 2 nd bluish green, last red, and others white): [5146], [Talaus | Lin. Cl. Ic. 45. f.1. | Cram.393.C. Fab. | Hüb. Lep. ex. Vol. II. | | Bah.Sello–Pará Sieb], [talaus | L. | (priassus | L. | phereclus | L. | peleus Cl. )], [DNA sample ID: | NVG-15032C12 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-24028H12 | c/o Nick V. Grishin ], [genitalia: | NVG241114-18 | c/o Nick V. Grishin ], and [HOLOTYPE ♀ | Entheus | lina Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. The holotype is one of four specimens in the lot number 5146, per the historical collection catalog, and was collected in Brazil either in Bahia by Friedrich Sello[w] or Pará by Friedrich Wilhelm Sieber. Considering substantial genetic differentiation between this new species and E. pralina from southern Brazil, we hypothesize that the holotype was collected in Pará.

Type locality. Brazil: Pará .

Etymology. The name is the last two syllables of the name of its sister species, shortened to indicate the more northern distribution of this species. The name is a noun in apposition.

Distribution. Currently known only from the holotype collected in Brazil, likely Pará.

MFNB

Museo Friulano di Storia Naturale

V

Royal British Columbia Museum - Herbarium

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

Family

Hesperiidae

Genus

Entheus

Darwin Core Archive (for parent article) View in SIBiLS Plain XML RDF