Entheus ecuadius Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 59-60

Entheus ecuadius Grishin , new species

http://zoobank.org/ 297F3822-5303-4CE1-8706-08138124207A ( Figs. 34j–k , 44 part, 48, 50 part, 51q)

Definition and diagnosis. A female from Ecuador is sister to Entheus dius Mabille, 1898 , stat. rest. ( type locality in Brazil) and is genetically differentiated from it at the species level ( Figs. 44 , 50 ); e.g., their COI barcodes differ by 2% (13 bp), thus representing a new species. This new species keys to “ Entheus matho dius ” (B.10.5(d)) in Evans (1952) but differs from its relatives by a combination of the following characters: the white area on the hindwing widening towards the inner margin instead of being constricted towards it at vein 1A+2A, smaller white spots on the forewing, and larger separation between the discal cell spot and the spot in cell CuA 1 -CuA 2. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly1651.31.1:G24A, aly1651.31.1:A95T, aly2548.15.2: T124C, aly2548.15.2:G168A, aly2548.15.2:C184T, aly1838.35.3:T48T (not C), aly1838.35.3:A66A (not G), aly1838.35.3:T112T (not A), aly6841.32.4:T1008T (not C), aly6841.32.4:T1014T (not A); and COI barcode: T97C, T157T (not C), A316G, T352C, T542T (not C), T595T (not C).

Barcode sequence of the holotype. Sample NVG-14062C11, GenBank PV550002, 658 base pairs: AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGATTATTAATTCGAACTGAATTAGGAACCCCTGGATCATTAATCGGAGATGATCAAATTTATAATACT ATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTTCTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGGGCTGGAACAGGATGAACAGTTTATCCTCCTTTATCCGCTAACATTGC CCATCAAGGATCTTCAGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATCTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATCTATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGACCCTGCTGGGGGGGGGGATCCAATTCTTTATCAACATTTATTT

Type material. Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Figs. 48 and 51q (genitalia Fig. 34j–k ), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ ECUADOR Napo | Archidona 800m | 10 Nov. '88 | S.S. Nicolay], [DNA sample ID: | NVG-14062C11 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23119E03 | c/o Nick V. Grishin ], [genitalia: | NVG240817-42 | c/o Nick V. Grishin ] , and one red [ HOLOTYPE ♀ | Entheus | ecuadius Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection.

Type locality. Ecuador: Napo Province, Archidona , elevation 800 m.

Etymology. The name is formed from the name of its sister species by adding ecua - for the county with the type locality. The name is treated as a noun in apposition.

Distribution. Currently known only from the holotype collected in the eastern slopes of the Andes of central Ecuador.

Figures

Fig. 34. Female genitalia of Entheus primary types, data in text (ductus bursae and bursa copulatrix not shown): a–c) E. talaus neotype and, simultaneously, Phareas serenus lectotype NVG-22091A04; d–f) E. hyponota sp. n. holotype NVG-22091B03; g–i) E. lina sp. n. holotype NVG-15032C12; j–k) E. ecuadius sp. n. holotype NVG-14062C11 in different views: a, d, g, j) ventral; b, e, h) left ventrolateral; c, f, i, k) right ventrolateral.

Fig. 44. Phylogenetic trees of Entheus matho group species inferred from protein-coding regions in: a) the nuclear genome (autosomes), based on 1,354,638 positions, b) the Z chromosome, based on 243,684 positions, and c) the mitochondrial genome. Ultrafast bootstrap (Minh et al. 2013) values are shown at nodes. Primary and secondary type specimens are labeled in red and blue, respectively. Branches of new taxa are shown in red and those with subspecies-to-species status change in blue.

Fig. 50. Phylogenetic trees of Entheus inferred from protein-coding regions in: a) the nuclear genome (autosomes), based on 3,486,282 positions, b) the Z chromosome, based on 279,462 positions, and c) the mitochondrial genome. Ultrafast bootstrap (Minh et al. 2013) values are shown at nodes. Different species groups and subgroups are colored: eumelus group (olive), gentius group (blue), priassus group (cyan, with telemus and pralina subgroups in purple and red, respectively), warreni group (magenta), and matho group (green). New taxa proposed in this work are labeled in red, and those with taxonomic changes, such as subspecies-to-species or synonym-to-species status (changes indicated in brackets), are labeled in blue.

Fig. 48. Entheus ecuadius sp. n. holotype ♀ NVG-14062C11 in dorsal (left) and ventral (right) views, data in text.

Fig. 51. Entheus specimens already illustrated above (data in text) shown life-size if printed on 8.5 by 11-inch paper for size comparison in dorsal (above each panel letter) and ventral (below) views: a) E. zeus sp. n. HT; b, c) E. priassus: b) NT, c) NT of =P. peleus; d) E. talaus stat. rest. NT & LT of =Ph. serenus; e, f) E. guyaneus sp. n.: e) HT, f) PT; g) E. lina sp. n. HT; h) E. colombeus sp. n. HT; i) E. proxemus sp. n. HT; j, k) E. peruveus sp. n.: j) PT, k) HT; l) E. hyponota sp. n. HT; m) E. guato sp. n. HT; n) E. pano sp. n. HT; o, p) E. venezuelius sp. n.: o) HT, p) PT; q) E. ecuadius sp. n. HT; r) E. bogoteus sp. n. HT.