Cecropterus (Thorybes) coxeyi (Williams, 1931)

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 66

Cecropterus (Thorybes) coxeyi (Williams, 1931) is a species distinct from Cecropterus (Thorybes) egregius (Butler, 1870)

Genomic analysis of Eudamus coxeyi Williams, 1931 (type locality Ecuador: Huigra, holotype sequenced as NVG-15096B02), currently treated as a subspecies of Cecropterus (Thorybes) egregius Butler, 1870 (type locality not specified), reveals that the two taxa are genetically differentiated at the species level ( Fig. 53 ); e.g., their Fst/Gmin/COI barcode difference are 0.37/0.014/1.2% (8 bp). The former taxon differs from the latter by being paler: e.g., forewing semi-hyaline spots are larger, the ventral hindwing ground color is pale brown, and hindwing fringes are white (Evans 1952). Therefore, we propose that Cecropterus (Thorybes) coxeyi (Williams, 1931) , stat. rest. is a species distinct from Cecropterus (Thorybes) egregius (Butler, 1870) . As a result, C. egregius becomes monotypic. The COI barcode sequence of the holotype of C. coxeyi , sample NVG-15096B02, GenBank PV550004, 658 base pairs, is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTTCCTCTTATATTAGGAGCTCCTGATATAGCTTTCCCTCGTA TAAATAATATAAGATTTTGATTATTACCCCCTTCATTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGTGCAGGTACTGGTTGAACTGTTTACCCCCCTTTATCTTCTAATATTGC TCATCAAGGAGCATCAGTAGATTTAGCAATTTTTTCTTTACATCTTGCAGGAATTTCATCTATTCTTGGAGCTATTAATTTTATCACAACTATTATTAATATACGAATTAATAATTTATCA TTTGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCTCTACTTTTATTACTTTCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAACTTAAATACTT CATTTTTTGATCCTGCAGGTGGGGGAGATCCTATTTTATATCAACATTTATTT

Figures

Fig. 53. Phylogenetic trees of selected Cecropterus (Thorybes) species constructed from protein-coding regions in: a) the nuclear genome (autosomes), based on 11,630,790 positions, b) the Z chromosome, based on 338,631 positions, and c) the mitochondrial genome. Ultrafast bootstrap (Minh et al. 2013) values are shown at nodes. Different species are colored differently: C. egregius (blue), C. coxeyi stat. rest. (red), C. virescens (cyan), C. chlorothrix (purple), C. notochlorothrix sp. n. (orange), and C. viridissimus (green). Primary type specimens are labeled in magenta.