Cecropterus (Thorybes) virescens (Mabille, 1877)

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 67

Cecropterus (Thorybes) chlorothrix (Röber, 1925) is a species distinct from Cecropterus (Thorybes) virescens (Mabille, 1877)

Genomic analysis of Eudamus chlorothrix Röber, 1925 (type locality Peru: Pasco, Huancabamba, holotype sequenced as NVG-18094D06), currently treated as a junior subjective synonym of Cecropterus (Thorybes) virescens (Mabille, 1877) (type locality given as “Cayenne” [ French Guiana?], syntype sequenced as NVG-15029F10), reveals that the two taxa are genetically differentiated at the species level ( Fig. 53 ); e.g., their Fst/Gmin/COI barcode difference are 0.18/0.012/2.3% (15 bp). Therefore, we propose that Cecropterus (Thorybes) chlorothrix (Röber, 1925) , stat. rest. is a species distinct from Cecropterus (Thorybes) virescens (Mabille, 1877) . The COI barcode sequence of the holotype of C. chlorothrix , sample NVG-18094D06, GenBank PV550005, 658 base pairs, is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCCCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTCTTATATTAGGAGCTCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCTCCCTCTTTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGTGCGGGTACTGGTTGAACTGTTTATCCCCCTTTATCTTCTAATATTGC CCATCAAGGAGCATCAGTAGATTTAGCAATTTTTTCATTACATCTTGCAGGAATTTCATCTATTCTTGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCA TTTGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCTTTATTATTATTACTTTCACTACCTGTTTTAGCTGGGGCCATTACTATACTATTAACTGATCGAAACTTAAATACTT CATTTTTTGATCCTGCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Figures

Fig. 53. Phylogenetic trees of selected Cecropterus (Thorybes) species constructed from protein-coding regions in: a) the nuclear genome (autosomes), based on 11,630,790 positions, b) the Z chromosome, based on 338,631 positions, and c) the mitochondrial genome. Ultrafast bootstrap (Minh et al. 2013) values are shown at nodes. Different species are colored differently: C. egregius (blue), C. coxeyi stat. rest. (red), C. virescens (cyan), C. chlorothrix (purple), C. notochlorothrix sp. n. (orange), and C. viridissimus (green). Primary type specimens are labeled in magenta.