Urbanus (Urbanoides) elma, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 71-72

Urbanus (Urbanoides) elma Grishin, new species

http://zoobank.org/ D77594CE-FE05-4EF4-94B2-5B45443632F7

( Figs. 58 part, 59)

Definition and diagnosis. A close sister to Urbanus elmina Evans, 1952 (type locality in Ecuador: Rio Pastaza), this new species keys to it (C.13.9) in Evans (1952) and Steinhauser (1981) and was included by them in that taxon, but is genetically differentiated from it at the species level ( Fig. 58); e.g., their COI barcodes differ by 3.2% (21 bp). The new species shares with U. elmina its “washed out appearance” of ventral hindwing markings ( Steinhauser 1981), i.e., darker bands are not prominent and are poorly contrasting with the ground color, but differs from U. elmina by a narrower and more elongated toward the tail hindwing and in females a narrower hindwing tail, wider semi-hyaline spots (e.g., in the forewing cell CuA 1 -CuA 2), a more extended semi-hyaline spot reaching (and in females crossing) the middle of the forewing cell CuA 2 -1A+2A, and slightly bluer (rather than greener) overscaling on the dorsal hindwing of females. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly27.17.6:C102G, aly3446.3.6:A40C, aly814.24.5:C36T, aly707.13.2:A96G, aly2178.51.8: A106G; and COI barcode: T43C, C220T, A268G, T439C, T581C, A619G.

Barcode sequence of the holotype. Sample NVG-19064C09, GenBank PV550008, 658 base pairs: AACCTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGCACTTCATTAAGATTACTTATTCGAACTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAATCCCCTTAATAATAGGAGCTCCTGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGATTATTGCCACCTTCACTAACTTTATTAATCTCAAGAAGAATTGTTGAAAATGGTGCCGGTACTGGATGAACAGTTTATCCCCCCCTTTCATCTAATATTGC CCATCAAGGAGCTTCTGTTGATTTAGCAATTTTTTCTCTACATCTTGCAGGTATTTCATCTATTCTTGGAGCTATCAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTACTATTATCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTAACTGATCGAAATTTAAATACCT CCTTTTTTGATCCGGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♀ deposited in the Bohart Museum of Entomology, University of California, Davis, CA, USA ( UCDC), illustrated in Fig. 59a, bears the following five printed rectangular labels, four white: [Merida | Libertador | Merida VZLA | VII 3 1979], [J McLaughlin | A A Grigarick | R O Schuster | R W Brooks], [ Urbanus elmina Evans, 1952 | female | Det. A. D. Warren, 2000], [DNA sample ID: | NVG-19064C09 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♀ | Urbanus (Urbanoides) elma Grishin]. Paratype: 1♂ NVG-24019F07 Colombia (no details), 1901, Stichel [ SMF] ( Fig. 59b).

Type locality. Venezuela: Merida , Libertador, Merida.

Etymology. The name is formed from the name of its sister species, U. elmina , made shorter to indicate the more northern distribution of the new species. The name is a noun in apposition.

Distribution. Currently known from Colombia and Venezuela.