Telegonus (Rhabdoides) flavifimbro Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Update to: Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (6), pp. 1-36 : 11-13

Telegonus (Rhabdoides) flavifimbro Grishin , new species

http://zoobank.org/ 16CBDDCE-329A-402A-9C25-25D6790F53EC ( Figs. 8 part, 9b–c)

Definition and diagnosis. Genomic analysis reveals that two females from Colombia, initially identified as Telegonus (Rhabdoides) chiriquensis Staudinger, 1875 (type locality in Panama: Chiriquí) are genetically differentiated from it at the species level ( Fig. 8); e.g., their COI barcodes differ by 4.1% (27 Grishin, 2025 (type locality in Costa Rica), also differing from it at the species level, e.g., COI barcodes of the holotypes differ by 4.0% (26 bp), and, therefore, they represent a new species. This new species keys to “ Astraptes chiriquensis chiriquensis ” C.14.30(a) in Evans (1952), but differs from it and other relatives by the following combination of characters in females: an iridescent area at the base of the dorsal forewing is similar to or more developed than in T. chiriquensis but less extensive and greener than in T. flavimargo ; the tornal area of the ventral forewing is even darker than in T. flavimargo ; a yellow submarginal region on the ventral hindwing is the broadest close to the middle of the wing and narrowing towards the tornus, slightly broader than in T. flavimargo ; a dark postdiscal band on the ventral forewing that is equidistant from the apical and discal bands (not closer to the apical band); more strongly expressed dark bands on the dorsal forewing; and more saturated in color and brighter orange-yellow fringes on the hindwing. Due to its cryptic nature and unexplored individual variation, this species is best

C52T, aly275209.7.3:G198A, aly3614.1.6:C40T, aly393.1.23:C57G. In the COI barcode, this new species may not differ from others due to mitochondrial introgression among its relatives.

Barcode sequence of the holotype. Sample NVG-24028C10, GenBank PV892286, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATCGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGACGATCAAATTTATAACACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATAATAGGAGCTCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGACTTCTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCACCAAGGAGCATCAGTTGATTTAGCTATTTTTTCCCTACATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATAAAAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTATGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT

Type material. Holotype: ♀ deposited in the Museum für Naturkunde, Berlin, Germany ( MFNB), illustrated in Fig. 9b, bears the following seven rectangular labels (first four handwritten, others printed), six white: [Columbia | 86 Klbr.], [201.], [ T. chiriquensis | ♀ var.], [chiriquensis | var.], [{QR Code} MfN URI | http://coll.mfn- | berlin.de/u/ | 09ec52], [DNA sample ID: | NVG-24028C10 | c/o Nick V. Grishin], and one red [HOLOTYPE ♀ | Telegonus (Rhabdoides) | flavifimbro Grishin ] . Paratype: 1♀: NVG-24039F01 Colombia, Boyacá, Muzo , Mar-1918, W. Gerstner leg. [ SMNS] ( Fig. 9c) .

Type locality. Colombia, possibly in the eastern Andes .

Etymology. Formed similarly to flavimargo , the name is given for the orange-yellow fringes (fimbia in Latin), particularly noticeable in the holotype of this species. The name is also longer to indicate a more southern distribution of this species and is treated as a noun in apposition.

Distribution. Currently known only from Colombia.