Telegonus (Rhabdoides) alector obscuratus Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Update to: Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (6), pp. 1-36 : 7-10

Telegonus (Rhabdoides) alector obscuratus Grishin , new subspecies

http://zoobank.org/ C615B4FA-4DD4-491D-B7EB-0C54C481D1DF ( Figs. 5 part, 6a)

Definition and diagnosis. Genomic analysis reveals that a male from Costa Rica initially identified as Telegonus (Rhabdoides) gilberti (Freeman, 1969) (type locality in Mexico: San Luis Potosí) is genetically

differentiated from it at the species level ( Fig. 5); e.g., their COI barcodes differ by 3.3% (22 bp). Instead, according to genomic trees, this male is most closely related to Telegonus (Rhabdoides) alector (C. Felder & R. Felder, 1867) (type locality in Colombia: Bogotá) while phenotypically differing from it by the lack of a white smudge on the dorsal forewing and smaller size ( Fig. 6a). This male is not prominently different genetically from the nominate subspecies of T. alector ( Fig. 6b). Therefore, due to phenotypic differences from it and Telegonus (Rhabdoides) alector ecuadoricus Grishin, 2025 (type locality in (incompletely) to “ Astraptes alector alector ” C.14.26(b) in Evans (1952), having blue rather than green wing bases, but males lack the white smudge in the discal area of the dorsal forewing. The new subspecies differs from other relatives by the following combination of characters in males: the dorsal side of wings is dark-brown with brilliant-blue (not green) bases and only a very weak trace (absent in T. gilberti ) of the discal forewing pale smudge in the cell CuA 1 -CuA 2; the ventral side of the wings is brown; the ventral forewing has a discal white band from within the discal cell widening to the vein 1A+2A and ending in a

length, somewhat overscaled orange-yellow at the very base; the ventral hindwing has a white triangular area by the costal margin (reaching to about its third) at the base, slightly overscaled with brown at the distal angle, but otherwise with a straight and sharply defined posterior edge; and orange-yellow body beneath. Due to its cryptic nature and unexplored individual variation, this subspecies is best identified by DNA, with diagnostic base pairs in the nuclear genome: aly259.26.2:A1801C, aly2250.22.2:A36C, aly1084. 16.5:C126T, aly 2370.12.8:T36C, aly1531.17.2:A310C, aly 1158.5.1:A351A (not G), aly1315.19.5:G78G (not C), aly1315.19.5:G81G (not C), aly1315.19.5:A90A (not C), aly322.10.7:T48T (not C). In the COI barcode, the new subspecies is not confidently different from the nominate subspecies.

Barcode sequence of the holotype. Sample NVG-24073H04, GenBank PV892285, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGTACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTACAATACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATAATAGGAGCCCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCATCAAGGAGCATCAGTTGACTTAGCAATTTTCTCTTTACATTTAGCTGGTATTTCTTCTATTCTTGGAGCTATTAATTTTATCACAACAATTATTAATATACGAATTAATAGCCTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATCACAGCATTATTATTATTACTTTCTTTACCAGTTTTAGCAGGAGCCATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 6a, bears the following four rectangular labels (1 st handwritten, others printed with handwritten text shown in italics), three white: [ C. RICA : PUNTARENAS | Corcovado; 20.ix.1976 | P. DeVries], [Allyn Museum | Acc. 19 78-20], [DNA sample ID: | NVG-24073H04 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) alector | obscuratus Grishin].

Type locality. Costa Rica: Puntarenas Province, Corcovado National Park .

Etymology. In Latin, obscuratus means darkened, made dark, or having become dark, and is given for the lack of the white smudge in the middle of the forewing in males characteristic of other T. alector subspecies. The name is a perfect passive participle.

Distribution. Currently known only from the holotype collected in southern Costa Rica.