Phaenoglyphis longicornis (Hartig, 1840)
publication ID |
https://doi.org/10.3897/BDJ.12.e120950 |
DOI |
https://doi.org/10.5281/zenodo.13820768 |
persistent identifier |
https://treatment.plazi.org/id/214CBB72-97C9-5ECB-8351-33369695CF53 |
treatment provided by |
|
scientific name |
Phaenoglyphis longicornis (Hartig, 1840) |
status |
|
Phaenoglyphis longicornis (Hartig, 1840)
Materials
Type status: Other material. Occurrence: recordedBy: GBOL III; individualCount: 1; sex: female; disposition: in collection; occurrenceID: D005101E-67AD-5398-BDA3-687A09723391; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: longicornis ; scientificNameAuthorship: (Hartig, 1840); Location: country: Germany; countryCode: DE; stateProvince: Hesse; municipality: Werra-Meißner-Kreis; locality: Frankershausen, Nat. res., " Kripp- und Hielöcher " (Loc. 5.2) ; verbatimElevation: 302 m; decimalLatitude: 51.2491; decimalLongitude: 9.9198; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 141; samplingProtocol: Malaise trap; eventDate: 2020-10 - 14 / 27; year: 1840; habitat: Small Pinus sylvestris forest with lots of dead wood; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2641246; basisOfRecord: PreservedSpecimen
Diagnosis
Antennae of both sexes with rhinaria beginning on F 1, pedicel shorter than F 1, F 1 longer than F 2, F 2 subequal to F 3, F 3 shorter than F 4 (Fig. 3 View Figure 3 c); pronotal carinae present, notauli present, scutellar foveae oval, with straight anterior and anterolateral margins, separated by median carina, open posteriorly (Fig. 4 View Figure 4 c), propodeal carinae present; radial cell closed, 2.7 times as long as wide.
Molecular characterisation
Maximum barcode-distance within species: not applicable (1).
(Minimum) barcode-distance to closest species: 4.9 % ( P. salicis ).
Barcode sequence (652 bp):
5 ’ - TTTATTGTATTTTATTTTTGGAATTTGATCGGGTATAATCGGGTCAGCTTTAAGAATAATTATCCGAATAGAATTAGGAACCCCATCTTCATTAATCGGTAATGATCAAATTTATAATTCAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTCATACCAATTATAGTAGGGGGATTTGGAAATTATTTAGTTCCTCTAATATTAAGTGCTCCTGATATAGCTTTCCCACGATTAAATAACATAAGTTTTTGATTATTACCTCCTGCTTTATTTCTATTAATTTCTAGAATATTTATTGATCAAGGGGCTGGAACTGGATGAACTGTTTATCCTCCTCTTTCATCTAATATAGGCCATTCAGGAATTTCAGTAGATTTAACTATTTTTTCTTTACATTTAAGGGGAATTTCTTCTATTTTAGGGGCTATTAATTTTATTTCAACAATTTTAAATATACGAATTATTTCTTTAGATAAAATTTCTTTATTTATTTGATCTATTTTTTTAACAACTATTTTATTATTATTATCATTACCTGTATTAGCAGGAGGAATTACTATATTATTATTTGATCGAAATTTAAATACTTCTTTTTTTGATCCAATGGGAGGGGGAGACCCTATTTTATATCAACATTTATTT- 3 ’
Distribution
France, Germany, India, Romania, Spain, Sweden and United Kingdom: England, Scotland ( Ferrer-Suay et al. 2023).
Taxon discussion
The species P. salicis and P. longicornis were inferred as conspecific only in the second-ranked partition in analyses with ASAP, but separate in all others, which is in line with our morphological concept of the two species.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |