Heraclides ponceana latefasciatus Grishin, 2020
|
publication ID |
9A8DCBC8-A9D5-4083-B640-BA5101827478 |
|
publication LSID |
lsid:zoobank.org:pub:9A8DCBC8-A9D5-4083-B640-BA5101827478 |
|
persistent identifier |
https://treatment.plazi.org/id/20298794-FF9F-FFAB-FED3-73476D2991F2 |
|
treatment provided by |
Felipe |
|
scientific name |
Heraclides ponceana latefasciatus Grishin |
| status |
subsp. nov. |
Heraclides ponceana latefasciatus Grishin , new subspecies
http://zoobank.org/ C835D721-548C-4822-9280-E241A1C94866 (Figs. 1, 2f–h)
Definition. This taxon differs from H. aristodemus in that the outer band of yellow spots on the forewing is more parallel to the inner band (and the outer margin) rather than approaching the inner band at an angle and giving an appearance of crossing the inner band; on the hindwing below there are more prominent red spots and more crescent-shaped blue spots that are better separated from each other, rather than forming a continuous band. This subspecies differs from all other H. ponceana subspecies by broader yellow central bands on both wings, less extensive brown coloration on the forewings below, a paler basal area and the lack of red spotting in the postdiscal area on hindwing above.
Type locality. Cuba: Guantánamo province, Rio Seco, San Carlos Estate .
Distribution. Known only from Cuba.
Etymology. The broad yellow bands are the most distinctive feature of this subspecies. The name is formed from the Latin words latus (wide, broad) and fascia (band, stripe). The name is an adjective.
Type material. Holotype male ( Fig. 2g), deposited in the American Museum of Natural History , New York, NY, USA ( AMNH), with the following 4 rectangular white (some faded to brownish) labels: printed, the date crossed out || San Carlos Est. | Guantanamo | Cuba. 4-8 X '13 ||; handwritten || May 1 '00 ||; printed with the numbers handwritten || Am. Mus. Nat. Hist. | Dept. Invert. Zool. | No. 20976 ||; printed || DNA sample ID: | NVG-14101H09 | c/o Nick V. Grishin ||. The red, rectangular, printed label || HOLOTYPE ♂ | Heraclides ponceana | latefasciatus Grishin || will be added to this specimen. Ten paratypes (when known, localities are given in parenthesis after specimen numbers): 5 males (NVG-14101H 10 in AMNH and NVG-14106A11 ( Matanzas), NVG-14106A12 ( Santiago), NVG-14106B01 ( Guantanamo) & NVG-14106B02 in USNM) and 5 females (NVG-14114B09 & NVG-14114B 10 in LACM and NVG-14106B03 & NVG-15104A01 (both from Santiago ) & NVG-15104A02 in USNM) .
Barcode sequence of the holotype. AACATTATATTTTATTTTTGGTGTTTGAGCAAGAATATTAGGAACTTCTCTTAGTTTATTA ATTCGAACTGAATTAGGAACTCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACCATTGTTACAGCTCATGCTTTTATTATAATTTTTT TTATGGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAA TATAAGATTTTGACTTTTACCTCCTTCTTTAACTCTTTTAATTTCAAGTATAATTGTCGAAAATGGAGCTGGAACTGGATGAACTGTTTATCCT CCCCTTTCTTCTAATATTGCTCATGGAAGAAGTTCAGTAGATTTAGTTATTTTTTCTCTTCATTTAGCGGGTATTTCTTCAATTTTAGGAGCAA TTAATTTTATTACTACTATTATTAACATGCGAATTAATAGAATATCCTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCTTT ATTATTACTCTTATCCTTACCCGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTCTTTGATCCTGCAGGA GGAGGAGATCCTATTCTATACCAACACTTATTT
Instead of proposing a new name for the Cuban broad-banded subspecies of H. ponceana , we entertained a possibility to request ICZN to designate one such specimen as the neotype of P. temenes , consistent with the current usage of this name, but contrary to the original description and the identity of three extant syntypes. However, we decided against this route for the following reasons. First, the name H. a. temenes is not in very wide use being applied to an uncommon endemic of a single island to warrant a special consideration by ICZN. Second, it seems most fair to respect original research that lead to creation of this name, and the original identity of this species that is quite clear even from its description alone (see above). Third, it is conceivable that the true P. temenes occurred (or even still occurs) in Cuba, and further research may show that it is not a synonym, but a valid subspecies of H. aristodemus , in which case it will be without a name if the neotype is designated to preserve the current usage of " temenes " as a subspecies of H. ponceana . It would create a nuisance situation when the original P. temenes would need a new name. Finally, a valid name that is suggestive of a diagnostic character ( latefasciatus) has an advantage of being easier to attribute to the taxon (compared to temenes ) and thus may be easier to remember.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
