Hermeuptychia canthe (Hübner, [1811])

Cong, Qian, Barbosa, Eduardo P., Marín, Mario A., Freitas, André V. L., Lamas, Gerardo & Grishin, Nick V., 2021, Two new species of Hermeuptychia from North America and three neotype designations (Nymphalidae: Satyrinae), The Taxonomic Report of the International Lepidoptera Survey 9 (7), pp. 1-21 : 8-9

Neotype designation for Hermeuptychia canthe (Hübner, [1811])

Meaningful integrative taxonomic revision of Hermeuptychia , a genus of many confusingly similar cryptic species, requires clarity about its nomenclature. Such clarity can only be achieved when all relevant names are objectively defined by their primary type specimens, and these specimens are sequenced to provide DNA datasets necessary for a more definitive identification and comparisons. No extant primary type specimens are known for Hermeuptychia canthe (Hübner, [1811]) . Although, as documented in the literature, most of Hübner types were likely lost ( Hemming 1937; Calhoun 2018), N.V.G. searched for possible H. canthe syntypes in the collections of the Muséum National d'Histoire Naturelle, Paris, France (MNHP), the Natural History Museum, London, UK (BMNH) and the Museum für Naturkunde, Berlin, Germany (ZMHB). These searches were unsuccessful, leading us to believe that the syntypes are no longer extant, and we proceed herein with a neotype designation. There is an exceptional need to designate the neotype of H. canthe . Kept as a junior subjective synonym for decades, H. canthe was resurrected by Viloria (2021) who used the name as valid. To unambiguously establish the identity of this species necessary for further work on this very challenging genus, a neotype that facilitates DNA-based studies is required. We believe that it is not possible to discern the cryptic diversity of Hermeuptychia without DNA comparisons ( Tan et al. 2021).

The original illustrations of Oreas strigata canthe Hübner, [1811] are identifiable as a Hermeuptychia , probably from Suriname ( Hemming 1937), largely brown unspotted dorsally, and ventrally with 5 eyespots on the forewing (including the one near the apex) and 6 on the hindwing ( Figs. 29, 30 ). All the eyespots on the illustrations are approximately the same size, e.g. those in hindwing cells R 5 -M 1 and CuA 1 -CuA 2 are not larger than others. The distance between the two brown lines on the ventral forewing increases towards the costa. We found a male specimen from Suriname that agrees with these distinctive features of the original illustrations and we hereby designate this specimen shown in Figs. 19, 20 , genitalia Fig. 34 , as the neotype of Oreas strigata canthe Hübner, [1811] . This species belongs to Hermeuptychia .

Our neotype of H. canthe satisfies all the requirements set forth by the ICZN Article 75.3.

Namely: 75.3.1. It is designated to clarify the taxonomic identity of O. canthe , which remained hypothetical until now, impeding research on Hermeuptychia ; 75.3.2. The characters that differentiate this taxon have been given above, as a description of the original illustrations, complemented here by the following features of male genitalia ( Fig. 34, 35 ): saccus long, only somewhat shorter than tegumen with uncus; "truncated" at the end, uncus with thin, membranous carina in basal half; valva about 4 times longer than its height, ventrally with a broad notch, cucullus long and narrow, terminally without teeth, aedeagus slightly longer than valvae. The COI barcode sequence of the neotype (GenBank accession OK641923 ) is:

AACTTTATATTTTATTTTTGGTATCTGAGCAGGAATAATTGGCACATCATTAAGTTTAATTATCCGAATAGAATTAGGTAATCCAGGATTTTTAATTGGAGATGACCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGTAATTGACTTATTCCCTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGTA TAAATAATATAAGATTTTGATTATTACCTCCATCTTTAATTTTATTAATTTCTAGTAGCATTGTAGAAAATGGAAGTGGAACTGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC TCATAGAGGTTCTTCTGTAGATTTGGCAATTTTTTCTCTTCACTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCT TATGATCAAATACCCCTATTTATTTGAGCCGTAGGAATTACAGCTCTCCTCTTACTTCTTTCATTACCTGTTTTAGCAGGAGCTATTACTATACTTCTTACTGATCGAAATTTAAATACAT CATTTTTTGACCCTGCAGGAGGAGGAGACCCCATTTTATATCAACATTTATTC

75.3.3. The neotype specimen is a male that bears the following five rectangular labels: [Gelderland, | Suriname River.], [Collection | Wm. Schaus], [genitalia | slide X-24-40 | W. D. F. #306], [DNA sample ID: | NVG-14061C10 | c/o Nick V. Grishin], and [NEOTYPE ♂ | Oreas canthe | Hübner, [1811] | designated by Grishin]; 75.3.4. Our search for the syntypes is described above, and it was unsuccessful, leading us to believe that they are no longer extant; 75.3.5. The neotype is consistent with what is known about this taxon, in particular with the original illustrations: e.g., on the ventral side, it has 5 eyespots on the forewing and 6 eyespots on the hindwing, all approximately the same size; 75.3.6. The neotype is from Suriname: Gelderland , Suriname River , and the syntypes were presumed to be from Suriname ( Hemming 1937); 75.3.7. The neotype is in the collection of the National Museum of Natural History , Smithsonian Institution , Washington, DC, USA ( USNM) .

Distances between barcodes of species with confidently assigned names and those from morphogroups defined by Seraphim et al. (2014) are illustrated here as a dendrogram ( Fig. 36 ). The neotype of S. canthe is a species from morphogroup 10 ( Seraphim et al. 2014). In agreement with Viloria (2021), we consider it to be a valid species, Hermeuptychia canthe (Hübner, [1811]). To facilitate recognition of this species, additional sequenced specimens from across its range are shown in Figs. 21–28 , and their genitalia are shown in Fig. 35 . In addition to its type locality in Suriname, this widely distributed species is recorded from Colombia, Guyana, French Guiana, Brazil (PA, MT, MG), Ecuador, Peru, and Bolivia, as evidenced by the specimens we studied ( Fig. 19–28, 34, 35 ), the DNA sequence search of the BOLD database queried with the neotype barcode ( Ratnasingham and Hebert 2007) and reports in the literature ( Seraphim et al. 2014; Tan et al. 2021).

Figures

Figs. 19–32. Hermeuptychia specimens. H. canthe: 19–20. neotype ♂, designated herein, Suriname: Gelderland, Suriname River, genitalia slide W. D. F. #306 (Fig. 34), DNA sample NVG-14061C10 [USNM]; 21–22. ♂, Peru: Madre de Dios, Amazonia Lodge, Atalaya, 491 m, 25-Sep-2011, leg. Steve Kinyon, #1907, DNA sample NVG-2649, genitalia NVG140628-17 (Fig. 35i) [USNM]; 23–24. ♀, Guyana: Region 9, Kanuku Mts., Nappi Creek, 03°20.7'N 59°34.2'W, 500'-1000', 21-Feb-10-Mar-1999, leg. S. Fratello, R. Hanner, S. Hendricks & R. Williams, USNM ENT 00232265, DNA sample NVG-2675, genitalia NVG140628-43 (Fig. 35l–m) [USNM]; 25–26. ♂, Colombia: Caqueta, Florencia, 6-Aug-1976, fairly wet hillside forest, leg. J. A. Scott, DNA voucher NVG-2798; 27–28. ♀, Suriname: Commewijne, De Nieuwe Grond, secondary forest, 2-Jun-1982, leg. Olle Pellmyr, DNA sample NVG-2644, genitalia NVG140628-12 (Fig. 35j–k) [USNM]; 29–30. illustrations of type specimens from the original description, not to scale (Hübner [1811]). 31–32. H. cantheus neotype ♂, designated herein, USA: Florida, St. Petersburg, 3-Nov-1938, leg. H. E. Wilford, DNA sample 11-BOA-15609E04 [USNM].

Fig. 36. COI barcode dendrogram constructed using BioNJ (Gascuel 1997) from Jukes-Cantor distances (Jukes and Cantor 1969) computed on the alignment after removal of all positions with gaps. Species names are given (and colored) only when they are determined with confidence. Species sequenced in Seraphim et al. (2014) are named by their morphogroup employed in that work. GenBank accessions are specified. Branches and species names for barcodes obtained in this work are shown in red. NT is neotype and HT is holotype. The dendrogram is rooted with the barcode of Megisto cymela| GU088434 (not shown). Due to insufficient phylogenetic signal in barcodes, the dendrogram may not reflect phylogeny and is only shown to illustrate divergence and similarity between barcodes.