Varicus lacerta, Tornabene, Luke, Robertson, D. Ross & Baldwin, Carole C., 2016
|
publication ID |
https://dx.doi.org/10.3897/zookeys.596.8217 |
|
publication LSID |
lsid:zoobank.org:pub:365F0CDD-3222-44F6-B93D-AD289BADD394 |
|
persistent identifier |
https://treatment.plazi.org/id/77FB8CDB-9B22-4F33-B76F-262C5606665F |
|
taxon LSID |
lsid:zoobank.org:act:77FB8CDB-9B22-4F33-B76F-262C5606665F |
|
treatment provided by |
|
|
scientific name |
Varicus lacerta |
| status |
sp. n. |
Taxon classification Animalia Perciformes Gobiidae
Varicus lacerta sp. n. Figs 1, 2, 3, 4, 5
Varicus lacerta Godzilla Goby
Type locality.
Curaçao, southern Caribbean.
Holotype. USNM 434796, male, 36.2 mm SL, Curasub submersible, sta. CURASUB15-24, southern Caribbean, Curaçao, east of downline off Substation Curacao dock, near 12.083 N, 68.899 W, 129-143 m, quinaldine, 24 September 2015, Carole C. Baldwin, Darryl Felder, Bruce Brandt and Jennifer Felder.
DNA barcode of holotype.
ATAAAGATATTGGCACCCTCTATTTGATCTTCGGCGCCTGAGCTGGCATAGTCGGCACTGCTCTAAGCCTTCTTATTCGGGCAGAGCTAAGCCAACCTGGCGCCCTTTTAGGGGATGACCAGATCTACAACGTGATCGTTACTGCCCACGCCTTCGTAATAATCTTCTTTATAGTAATACCCGTCATGATTGGGGGCTTTGGGAACTGGCTCGTCCCTCTTATGATTGGGGCCCCCGATATGGCCTTTCCCCGAATAAATAACATAAGCTTCTGACTCCTCCCCCCCTCTTTCCTCCTGCTCTTAGCCTCCTCCGGCGTTGAAGCAGGCGCTGGCACAGGGTGAACCGTATACCCCCCCCTAGCCGGAAACCTCGCCCACGCCGGGGCCTCTGTTGATTTAACAATTTTTTCCCTCCACTTAGCAGGCATTTCCT CAATCCTAGGAGCCATTAACTTTATTACCACCATCCTCAACATAAAGCCCCCAGCAATCTCGCAATATCAAACCCCCCTTTTTGTATGGGCCGTGCTAATTACGGCTGTTCTTCTATTACTCTCCCTGCCCGTCCTAGCTGCAGGAATTACAATACTTCTTACCGATCGTAACCTAAATACAACCTTTTTTGACCCCGCAGGAGGGGGAGACCCCATTCTCTACCAACACCTCTTCTGATTCTT
Generic placement.
In addition to molecular characters supporting the phylogenetic placement (Fig. 1), the following morphological characters support the inclusion of the new species in Varicus : first dorsal spines VII; dorsal-fin pterygiophore formula 3-221110; vertebrae 11+16; hypurals 1-2 and 3-4 partially fused; one anal-fin pterygiophore inserted anterior to first haemal spine; anal-fin rays I,9 or fewer (I,7 in Varicus lacerta ); head pores absent; transverse papillae rows 5i and 5s connected as a single continuous row; pelvic fins completely separate, lacking both anterior frenum and membrane connecting bases of innermost pelvic-fin rays; fifth pelvic-fin ray unbranched.
Diagnosis.
Second dorsal fin I,9; anal fin I,7; pectoral fin 18; no scales; cephalic papillae rows 5s and 5i connected, forming a single row; pelvic rays 1-4 highly branched and feather-like; one anal-fin pterygiophore inserted anterior to first haemal spine; body with five broad, indistinct, dark vertical bands washed with bright yellow in life; pelvic, pectoral and anal fins yellow-orange in life, dorsal, anal, and caudal fins yellow with faint orange tint.
Description.
General shape: body robust, widest and deepest at head, trunk tapering in width and depth posteriorly, dorsal head profile gradually sloping from dorsum to lips.
Median and paired fins: first dorsal fin VII, second spine longest, tips of spines projecting from fin membrane; second dorsal fin I,9, last ray branched to the base; anal fin I,7, last ray branched to the base; pectoral fin 18/18, fin extending posteriorly to vertical through anus; pelvic fins I,5, fins well separated, lacking both anterior frenum and membrane connecting bases of innermost rays; 4th pelvic-fin ray longest, extending posteriorly to anus; rays 1-4 connected by a thin membrane, each ray with one primary bifurcation followed by numerous thin branches off main branch that are united by a continuous membrane to the tip of the ray, giving each ray a feather-like appearance; 5th ray unbranched and 60-70% the length of 4th ray; caudal fin rounded, branched caudal-fin rays 15, segmented caudal-fin rays 17.
Squamation: no scales on head and trunk.
Head: jaw terminal, angled approximately 40 degrees from horizontal axis of body, extending posteriorly to a vertical at anterior end of pupil; anterior nares elongate narrow tubes; posterior nares inconspicuous openings covered by a short flap; no cephalic lateralis pores on head or preopercle; eyes large, dorsolateral, extending slightly above head profile; interorbital space narrow; operculum opening slightly wider than width of pectoral-fin base; teeth in upper jaw in two rows, outer row enlarged, canine-like, recurved, and evenly spaced, extending along most of premaxilla; inner rows smaller, more numerous, and more tightly spaced; teeth in lower jaw in three rows, outermost and innermost rows slightly enlarged, middle row smaller and more numerous; tongue truncate, tip with very slight indentation.
Morphometrics (% SL): head length 33.1; eye diameter 9.4; interorbital 2.6; snout length 8; upper-jaw length 12.4; predorsal length 40.1; body depth at origin of first dorsal 19.1; body depth at anal-fin origin 15.2; body depth at caudal peduncle 10.2; caudal-peduncle length 21.1; pectoral-fin length 24.0; pelvic-fin length 26.0; caudal-fin length 27.1.
Genitalia: male with short, conical, pointed papilla, wide at base and tapering distally to a point, no melanophores present; female unknown.
Color in life (Figs 2, 3): Ground color pale grey, head and body spangled with tiny silver and black dots, upper two-thirds of head and upper half of body with yellow tint that is more visible when fish photographed against white vs. black background (Figs 2 and 3, upper panel); breast, lower portions of head and opercle, chest, and lower portion of belly pale pinkish white.
Head with areas of bright yellow pigment heavily speckled with black dots on snout, along upper lip, as an irregular blotch over most of opercle, in a broad band across nape, and as two irregular bars below the eye, one beneath center of eye and extending to rear corner of mouth, the other running obliquely back from posteroventral corner of eye to lower corner of preopercle; iris greenish yellow, heavily speckled with silver and black dots; a thin silvery-white inner ring around pupil.
Body with four broad yellow bars heavily speckled with black dots, one on upper half of body under first dorsal fin; second and third extending from dorsal midline nearly to ventral midline, second positioned under anterior half of second dorsal fin and third under posterior corner of second dorsal and anterior half of caudal peduncle; fourth and narrowest bar covering most of posterior end of caudal peduncle and extending onto base of caudal fin; first three body bars (and bar across the nape) appearing as double bars due to irregular pale blotches in centers; interspaces between first three body bars with small, black-speckled yellow blotches and short, thin yellow bars; pale areas on head and trunk with silver, iridescent markings that are most conspicuous along mid-flank in the photograph of the live fish (Fig. 2)
First dorsal fin yellow with fine yellow and orange dots on the inner two-thirds of fin, gradually replaced with silvery white dots on membranes of outer one fourth of fin; second dorsal fin similarly colored, but with silvery speckling predominating on outer one-third of fin. Basal three-quarters of caudal fin yellow, spangled with orange (mainly) and whitish dots; outer one-quarter of fin with rays gray and membranes translucent with heavy silver-white speckling, rear edge of fin with darker grey pigment suffused with orange. Anal fin orange, strongly so distally in live fish and basally in freshly dead fish (Figs 2, 3, respectively); outer half of fin membranes heavily speckled with dark brown dots; fin rays with yellow tint distally. Pectoral-fin base white, heavily spangled with silver dots, a large, black-speckled yellow blotch on upper corner and a similar, smaller, more diffuse yellow blotch on lower corner; rays pink basally, orange-red speckled with silver centrally, fading to pink distally; sparse silver spangles scattered over fin. Pelvic fins pale, washed with pinkish-orange speckling.
Color in preservation (Fig. 4): Ground color yellowish pale, snout and mouth pale gray; various dark marks present in live fish visible in preserved fish as concentrations of dark brown dots: two indistinct short dark bars under eye: dark blotch on nape; four dark bars on body and at end of caudal peduncle; dark blotches at top and bottom corners of pectoral base.
Sensory papillae (Fig. 5): sensory papillae well developed, with notably elongate papillae on nape, snout, cheek, and ventral surface of head, giving head a hairy or spikey appearance (visible in Figs 2 and 3, less obvious in preservation); a series of 5 transverse papillae rows on side of head; transverse papillae rows 5i and 5s united as a single continuous row positioned anterior to row b, continuing ventrally below row d; interorbital papillae series well developed, each side of the interorbital possessing 2 pb’ papillae, 1 pc’ papilla, 2 pd’ papillae, 3 pe’ papillae, and a cluster of 3-4 pf’ papillae.
Vertebral skeleton: dorsal pterygiophore formula 3-221110; one anal-fin pterygiophore inserted anterior to first haemal spine; second neural spine expanded and slightly spatulate at tip; hypurals 1-2 fused with hypurals 3-4 along approximately one-half of their length; 27 vertebrae, 11 precaudal, 16 caudal.
Habitat.
The only known specimen was collected at 129-143 m. Quinaldine was dispersed around a yellow sponge (~20 cm tall) tentatively identified from videos by Allen Collins (National Marine Fisheries Service) as Dactylocalyx pumiceus , situated on a rocky outcropping along the deep-reef slope. After approximately 20 seconds the stunned fish emerged from a space in the rocky substrate at the base of the sponge and was captured. It is unclear whether the fish was originally in direct association with the sponge itself or was instead sheltering in spaces within the rock. Video of the capture taken from a high-definition video camera mounted on the outside of the Curasub is available online (https://youtu.be/UvxJEi-vER0). Subsequent collections targeting similar sponges and rocky substrates within this depth range at the type locality have not yielded additional specimens.
Distribution.
Known only from the type location in Curaçao.
Etymology.
The specific epithet ‘lacerta’ (Latin for ‘lizard’) is in reference to the reptilian or saurian appearance of this species, as indicated by its bright yellow and orange coloration, green eyes, disproportionately large head possessing raised ridges of papilla, and multiple rows of recurved canine teeth in each jaw. The common name Godzilla goby (gobio Godzilla in Spanish) refers to the radioactive reptilian monster from the sea that appeared in Japanese science-fiction films as Gojira, renamed Godzilla in subsequent English-language films.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
