Halpe sikkima Moore, 1882
|
publication ID |
https://doi.org/10.11646/zootaxa.4486.1.7 |
|
publication LSID |
lsid:zoobank.org:pub:77386C47-B5F9-425C-BD0D-B8116B20403B |
|
DOI |
https://doi.org/10.5281/zenodo.5955647 |
|
persistent identifier |
https://treatment.plazi.org/id/03F1FB2E-DD1C-FFEF-4381-FC2DFBFEED9F |
|
treatment provided by |
Plazi |
|
scientific name |
Halpe sikkima Moore, 1882 |
| status |
|
Halpe sikkima Moore, 1882 View in CoL ( Fig. 1 View FIGURE 1 )
Halpe sikkima Moore, 1882: 407 View in CoL , TL: Sikkim; Elwes & Möller, 1888: 453; Evans, 1949: 260; Eliot, 1992: 350; Osada et al., 1999: 192; Yuan et al., 2007: 310; Ek-Amnuay, 2012: 828; Yuan et al., 2015: 397; Monastyrskii & Devyatkin, 2016: 77.
Halpe selangora Swinhoe, 1913: 283 View in CoL , TL: Selangor, Malaya. Synonymised by Evans, 1949.
Distribution. Sikkim to Indochina, Hainan, Malay Peninsula, Borneo, Sumatra, Java.
Material examined. 1 3, Wuzhishan, Hainan, China, 15.IV.2015, G.X. Xue leg.
Male genitalia ( Fig. 2 View FIGURE 2 ). In dorsal view, tegumen slightly tapered; uncus basally constricted and distally expanded, its end deeply bifid into a pair of inwardly curved blunt-pointed horns. Lateral processes reach to half of the horns of uncus, ventral side with a small hook in the middle, distal half thinner and tapered. Gnathos distally tapered and left and right parts separated from each other. Saccus short. Dorsal margin of valva slightly bifid in the middle, basal half flat, without footstalk; distal half densely furnished with strong sawteeth, dorsal margin widely U-shaped, forming a triangular basal branch and a narrower elongated distal branch, of which the distal margin is shallowly indented to form a strong upper branch and a small lower branch. Aedeagus shorter than ventral margin of valva, suprazonal sheath tapered toward fore-end, dorsal margin of subzonal sheath deeply concave. Juxta quadrangular.
COI sequence. Genbank Accession MH444659 View Materials , voucher HaiN-A32, 661 base pairs: ATTCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCT CTAAGATTATTAATTCGTACTGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTAT TGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACT AGTTCCCCTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGAATGTTACCCC CTTCTTTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGTACCGGATGAACAGTTTACCCCC CTCTTTCTTCTAATATTGCTCATCAAGGTTCATCCGTTGATTTAGCTATTTTTTCCTTACATTTAGCAGGTATTT CCTCAATTTTAGGGGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAA TACCTTTATTCGTTTGAGCTGTAGGAATTACTGCTTTACTTTTATTACTTTCATTACCAGTTTTAGCTGGAGCT ATTACAATATTATTAACTGATCGAAATTTAAATACtTCTTTTTTTGATCCTGCAGGAGGAGGAGATCC
Remarks. Evans (1949) recorded one male Halpe sikkima from Hainan. Since then, no more material of this species has been collected from this place again, although field surveys have been carried out on the island repeatedly, and a number of hesperiid species have been published as new to science ( Chou 1994; Fan et al. 2007a; Fan et al. 2007b; Fan & Chiba 2008) or discovered as new records to the skipper fauna of China ( Fan et al. 2003; Fei et al. 2015). In recent literature specializing in the fauna of Hainan skippers (e.g. Gu & Chen 1997; Gu 2002; Chiba 2008), this species was not included. Thus, H. sikkima remained a mysterious species in Hainan, and its occurrence on the island needed reconfirmation. During a collecting trip at Wuzhishan ( Fig. 3 View FIGURE 3 ) in 2015, a male H. sikkima was captured by the first author of the present paper, representing the second specimen of this species from the island. Considering the figures and descriptions of the male genitalia in literature which are not complete and precise enough ( Evans 1949; Maruyama 1991), illustrations and a re-description are provided in this paper. DNA was extracted from one leg of the dried specimen using DNeasy ® Blood and Tissue Kit (Qiagen, Germany). The COI gene was amplified by PCR as described by Hajibabaei et al. (2006) and then sequenced by Sangon biotech, Shanghai, China. The COI sequence is published herein for the potential use in DNA barcoding and a molecular phylogeny study in the future.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
SubFamily |
Hesperiinae |
|
Genus |
Halpe sikkima Moore, 1882
| Xue, Guoxi, Lv, Hongkun, Hu, Neng, Yin, Weizhi & Li, Meng 2018 |
Halpe sikkima
| Elwes & Möller, 1888 : 453 |
| Evans, 1949 : 260 |
| Eliot, 1992 : 350 |
| Osada et al., 1999 : 192 |
| Yuan et al., 2007 : 310 |
| Ek-Amnuay, 2012 : 828 |
| Yuan et al., 2015 : 397 |
| Monastyrskii & Devyatkin, 2016 : 77 |
