Celotes sabinus, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Butterfly classification and species discovery using genomics, The Taxonomic Report of the International Lepidoptera Survey 11 (3), pp. 1-94 : 64-66

Celotes sabinus Grishin, new species

http://zoobank.org/ 085EAF93-91A9-4F81-886C-0E77073C8B0E ( Figs. 41 part, 42, 43a)

Definition and diagnosis. Inspection of genomic trees reveals that Celotes nessus (W. H. Edwards, 1877) (type locality USA: Texas, Bexar Co., San Antonio; lectotype sequenced as NVG-15097F12) as currently circumscribed ( Fig. 41 blue and red) is not monophyletic, and populations from the eastern part of the range ( Fig. 41 blue) are sister to Celotes spurcus A. Warren, Steinhauser, Hernandez-Mejía & Grishin, 2008 (type locality in Mexico: Querétaro) ( Fig. 41 green). While species, in general, do not have to be monophyletic, populations currently identified as C. nessus from the western part of the range ( Fig. 41 red) are genetically differentiated from the eastern populations (which include nominotypical) at the level characteristic of distinct species, with Z chromosome Fst / Gmin of 0.32/0.008 and COI barcode difference a species distinct from C. nessus . This western species does not have a name because the only two junior synonyms of C. nessus : Spilothyrus notabilis Strecker, [1878] (type locality in the USA: Texas, vicinity of New Braunfels and San Antonio; two syntypes sequenced as NVG-15039C06 and NVG-15039C07) and Carcharodus radiatus Plötz, 1884 (type locality in USA: Texas, syntypes not located, attributed to a species by locality), are conspecific with the eastern species. This new species is distinguished from C. spurcus by approximately two times shorter process of valva (from the base of ampulla), which is similar in length to C. nessus , and from C. nessus by terminally broader harpe, wider separation between harpe and ampulla (broader gap between them), wider process of valva, broader valva narrowing less towards vinculum, and two small teeth on aedeagus shaft: by its bend and halfway between the bend and distal end (Fig. 43). A combination of the following nuclear genomic characters is diagnostic: aly2284.30.1: G1323A, aly40182.1.2:C154A, aly40182.1.2:C171T, aly 1445.3.1:G246A, aly 1445.3.1:A195G.

Barcode sequence of the holotype: Sample NVG-22105 A02, GenBank OR578720 , 658 base pairs: AACTTTATATTTCATTTTTGGAATTTGAGCAGGCATAGTAGGTACTTCTCTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTCTAATTGGGGATGATCAAATTTATAATACT ATTGTAACAGCACATGCCTTCATTATAATTTTTTTTATGGTAATGCCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCTGATATAGCATTCCCACGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTTTAACACTTCTTATTTCAAGAAGTATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCTCTATCATCTAATATTGC TCATCAAGGTTCATCTGTTGACTTAGCTATCTTTTCTTTACATCTAGCAGGAATTTCATCAATCTTAGGAGCAATTAACTTCATTACAACTATTATTAATATACGAATTAGAAATTTATCA TTTGATCAAATACCTTTATTCGTATGAGCTGTAGGAATTACAGCATTACTTTTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACAT CTTTCTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTT

Type material. Holotype: ♂ deposited in the California Academy of Sciences, San Francisco, CA, USA [ CAS], illustrated in Fig. 42, bears seven printed labels (date on the first label handwritten): six white [Sabino Cany. | Santa Catalina Mts. | Pima Co. Arizona | 1. IV. 60], [collected by | Kilian Roever], [Collection of | J. W. Tilden], [ JAMES W. TILDEN | COLLECTION – 1985 | Gift to the California | Academy of Sciences], [DNA sample ID: | NVG- 22105A02 | c/o Nick V. Grishin ], [{QR Code} CASENT | 8568344], and one red [HOLOTYPE ♂ | Celotes sabinus | Grishin ]. Paratypes: 13♂♂, 4♀♀: USA, Arizona: Mohave Co., 1♀ Hualapai Mts., lower el., 16-Apr-2008, Ken Davenport leg. ( NVG-20065 A08, CSU _ ENT 1024696) [ CSUC]; 1♂ nr. Wickieup, 30-Mar-1972, J. W. Tilden leg. ( NVG-22104 H11, CASENT 8568341) [ CAS]; 1♀ Yavapai Co., 8 mi SW of Prescott, 21-Apr-1976, James W. “Bill” Tilden leg. ( NVG- 22105A03, CASENT 8568345) [ CAS]; 1♂ Maricopa Co., Camp Creek on Cave

Creek Rd., 12 mi NE of Jct. of Cave Creek and Scottsdale Rds., 8-Apr-1968, J. A. Miller leg., genitalia NVG140320-91 ( NVG- 2250) [ TAMU]; 1♂ Gila Co., Sevenmile wash, 22-Aug-1960, P. A. Opler leg. ( NVG- 22104H12, CASENT 8568342) [ CAS]; 1♂ Pinal Co., Coronado National Forest, Santa Catalina Mts., Peppersauce Canyon , 26-Mar-2017, Q. Cong, J. Zhang, and N. V. Grishin leg. ( NVG- 8304); Pima Co.: 1♂ Baboquivari Mts., Brown Canyon, 21-Mar-1938, J. W. Tilden leg., genitalia J.W. T. 25-15 ( NVG-22104 H08, CASENT 8568338) [ CAS] (Fig. 43a); 1♂ Santa Catalina Mts., Molino Basin , 7-Sep- 1951, C. D. MacNeill leg. ( NVG- 22105A01, Fig. 43. Male genitalia of Celotes from USA, in lateral view. CASENT 8568343) [ CAS]; Santa Cruz Co.: 1♂ a) Celotes sabinus sp. n. paratype, slide J. W. T. 25-15, AZ: Pena Blanca Canyon, 11-Jul-1981, Jim P. Brock Baboquivari Mts., Brown Canyon, 21-Mar-1938, DNA sample

NVG-22104 H08. b) Celotes nessus , slide 25-16 , TX: George leg. ( NVG-2115 ); 2♂♂ Walker Canyon nr. Pena West, 12-Jun-1940, DNA sample NVG-22104 H10. Specimens Blanca Lake , 16-Aug-1972, John Hafernik leg., are in CAS, collected and genitalia prepared by J. W. Tilden. genitalia NVG140320-92 & -93 ( NVG-2251 & Genital capsule is shown on the right, separated valva is on the left with aedeagus above it. Aedeagus of C. sabinus is shown NVG-2252 ) [ TAMU]; 1♂ Pajarito Mtns., Califor-

in ventrolateral view as mounted on the slide. nia Gulch, 30-Mar-2016, N. Grishin leg. ( NVG-5997); 1♂ Patagonia , 24-Mar-1938, J. W. Tilden leg. ( NVG-22104 H09, CASENT8568339 ) [ CAS] ; 1♀ 3.5mi SW of Patagonia , 6-Aug-1978, Jim P. Brock leg. ( NVG-2116 ) ; Mexico: Sonora: 1♂ 16 mi E of Tecoripa , 15-Mar-1984, Jim P. Brock leg. ( NVG-2114 ) ; 1♀ 8 mi W of Rio Yaqui , 16-Mar-1984, Jim P. Brock leg. ( NVG-2113 ) ; 1♂ ca. 8 mi NE of Bavispe , elevation ca. 4000’, 25-Mar-1998, Richard W. Holland leg. ( NVG-20066 B02, CSU _ ENT1024701 ) [ CSUC] .

Type locality. USA: Arizona, Pima Co., Santa Catalina Mountains, Sabino Canyon .

Etymology. The name is formed from the type locality of this species, Sabino Canyon, a place familiar to many naturalists, which is just northeast of Tucson at the foothills of the Santa Catalina Mountains in southeastern Arizona, where this species is common. The name is a masculine adjective.

English name. Arizona streaky-skipper.

Distribution. Currently known from USA: Arizona and Mexico: Sonora and is likely present in southwestern New Mexico.

Comment. We were surprised to learn that C. sabinus sp. n. is more distant from C. nessus than morphologically distinct C. spurcus , which is rather close to C. nessus genetically.