Acleros (Isocleros) togo, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Butterfly classification and species discovery using genomics, The Taxonomic Report of the International Lepidoptera Survey 11 (3), pp. 1-94 : 71-72

Acleros (Isocleros) togo Grishin, new species

http://zoobank.org/ 10245D25-D8E1-4342-A2AA-0104A185EA97

( Figs. 45–46 part, 47)

Definition and diagnosis. Genomic trees reveal that two specimens from Western Africa identified as Acleros olaus (Plötz, 1884) , stat. rest. (type locality in Congo, syntype sequenced as NVG-18073C07) are not monophyletic with A. olaus and form a clade approximately equidistant from it and Acleros mackenii (Trimen, 1868) (type locality in South Africa, possible syntype sequenced as NVG-20126G11) with Acleros instabilis Mabille, 1889 , stat. rest. (type locality in Tanzania) ( Figs. 45, 46), suggesting that these two specimens belong to a distinct species. Its genetic differentiation measured by Fst /COI barcode difference is: 0.31/5.5% (36 bp) from A. olaus , 0.31/4.7% (31 bp) from A. mackenii , and 0.41/5.3% (35 bp from A. instabilis , which is substantial and provides strong support for these two specimens as combination of characters: forewing subapical spots are present, yellowish above and purplish beneath (not white in the specimens of the type series), diffuse, nearly in line (spot by costa is not strongly offset distad from others), other forewing spots are crisper, with sharper defined edges, the spot in cell CuA 2 - 1A+2A on ventral forewing is with equally sharp edges (not more diffuse and disappearing towards the outer margin), forewing spot in cell CuA 1 -CuA 2 is closer to the spot in cell CuA 2 -1A+2A than in A. olaus . Due to variability in phenotype, this rather cryptic species is confidently identified by DNA: in the nuclear genome: aly164.2.2:C73A, aly173.7.6:A182T, aly8937.5.1:A305G, aly1260.26.1:A247G, aly24.4.2: G63T and in the COI barcode: T38A, T91C, T376A, G380A, A514C, T571C.

Barcode sequence of the holotype: Sample NVG-22017 G12, GenBank OR589638 , 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATAATAGGATCATCTTTAAGATTATTAATTCGTACAGAATTAGGTAACCCTGGATCCTTAATCGGAGATGATCAAATTTATAATACA ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTCTTATATTAGGAGCTCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGAATACTTCCCCCATCTTTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACTGGCTGAACTGTTTACCCCCCTCTTTCTTCTAATATTGC ACATCAAGGATCATCAATTGATTTAGCTATTTTTTCTTTACATTTAGCCGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAAAAATATATCA TTTGATCAATTACCTTTATTTATTTGATCCGTAGGTATTACTGCTTTACTTTTACTTTTATCTCTACCTGTTTTAGCAGGTGCTATCACAATACTTCTTACTGACCGAAACTTAAATACTT CTTTTTTCGATCCTGCCGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the Zoologische Staatssammlung München, Germany [ ZSMC], illustrated in Fig. 47a, bears six labels: 2 nd blue, last red, and others white [43390], [ Togo | Misahöhe | 1893 | E. Baumann S.], [363 | 7.XII.93 | A. olaus ], [olaus | Plötz], [DNA sample ID: | NVG- 22017G12 | c/o Nick V. Grishin ], and [HOLOTYPE ♂ | Acleros (Isocleros) | togo Grishin]. Paratype: ♀ Liberia: Monrovia, Firestone Plantation, Dec-1946, Harry A. Beatty leg. ( NVG- 22047H11) [ CUIC] ( Fig. 47b).

Type locality. Togo: Misahöhe .

Etymology. The name is given for the country with the type locality. The name is a noun in apposition.

Distribution. Western Africa, recorded from Togo and Liberia.

Taxonomic rearrangement of species currently in the genus Meza Hemming, 1939

The genus Meza Hemming, 1939 (type species Hesperia meza Hewitson, 1877 ) currently consists of 10 species. Genomic trees reveal that the genus is not monophyletic ( Figs. 45, 46) and partitions according to the three sections of the identification key provided by Evans (1937): (i) no secondary sexual characters; (ii) male dorsal hindwing with a hair tuft that overlays bases of veins CuA 1 and CuA 2 and (iii) hair tuft enters a pouch either at the end of discal cell or along the median vein. The type species M. meza — section (i), no tuft—belongs to the tribe Ceratrichiini Grishin, 2019 and other species (with tuft) belong to two clades in the tribe Astictopterini Swinhoe, 1912 . Section (ii) consists of three species and is sister to the genus Fresna Evans, 1937 (type species Hesperia netopha Hewitson, 1878 ). Although this clade is prominent, it is at the tree level of a subgenus ( Figs. 45, 46). We include these species in Fresna , forming the following new combinations: Fresna larea (Neave, 1910) , comb. nov., Fresna leucophaea ( Holland, 1894), comb. nov., and Fresna mabea ( Holland, 1894), comb. nov. All the remaining species are from section (iii) and are dispersed within the clade corresponding to the genus Paronymus Aurivillius, 1925 (type species Hesperia ligora Hewitson, 1876 ) ( Figs. 45, 46). We assign them to this genus, forming new combinations: Paronymus banda ( Evans, 1937) , comb. nov., Paronymus cybeutes ( Holland, 1894), comb. nov., Paronymus elba ( Evans, 1937) , comb. nov., Paronymus gardineri (Collins & Larsen, 2008) , comb. nov., Paronymus indusiate (Mabille, 1891) , comb. nov., Paronymus mabillei ( Holland, 1893), comb. nov. As a result, Meza becomes monotypic to consist of only the type species M. meza , while other species currently in Meza are transferred to Fresna or Paronymus .