Semalea malawi, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Butterfly classification and species discovery using genomics, The Taxonomic Report of the International Lepidoptera Survey 11 (3), pp. 1-94 : 75-76

Semalea malawi Grishin, new species

http://zoobank.org/ A1AA303B-9ABF-4F7C-B84B-2ABD765583DF

( Figs. 45–46 part, 48)

Definition and diagnosis. The mitochondrial genome tree reveals that a specimen from Malawi identified as Semalea vibius (Hewitson, 1878) , comb. nov. (type locality in Gabon) is sister to both S. vibius and Semalea rega (Mabille, 1889) , comb. nov. (type locality in Sierra Leone) ( Fig. 46), suggesting that it is a third species distinct from them. We sequenced primary type specimens of all four names associated with S. rega and confirmed their synonymy ( Figs. 45, 46). Specimens from western Africa ( Cameroon, Congo) serve as references for S. vibius . Therefore, the third species is new. In the COI barcode, it differs from S. vibius by 1.1% (7 bp), which is larger than the difference between S. vibius and S. rega of 0.6% (4 bp). Despite this moderate difference in the barcode, Fst / Gmin of 0.35/0.008 for S. vibius and S. rega indicate that they are distinct species, in agreement with phenotypic distinction. However, we could not compute these statistics for the new species because it is known from a single specimen (at least two specimens are needed). This new species is distinguished from its relatives by the lack of subapical spots on the forewing, larger forewing orange patch that reaches closer to the outer margin, palpi beneath and cheeks more orange than yellow in color, and largely brown ventral hindwing, which is unspotted, and sparsely overscaled with orange. Due to variability in phenotype, confidently identified by DNA: in the nuclear genome: aly281.6.2:A130G, aly281.6.2:C131T, aly 1249.8.1:T514C, aly1603.31.1:A370C, aly37338.23.1:C264T, aly54.4.1:T1461T (not A), aly6648.1.2:A161A (not C), aly5294.20.2:T630T (not C), aly386.8.2:A506A (not T), aly393.3.1:A492A (not G) and in the COI barcode: T88C, T118C, T139A, T202C, T547T, T610T, T646T.

Barcode sequence of the holotype: Sample NVG-19043 B12, GenBank OR589640 , 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATATTAGGAACATCTTTAAGTTTATTAATTCGAACTGAATTAGGTAATCCTGGCTCATTAATTGGAGATGATCAAATTTATAACACA ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGATTACTTCCCCCCTCCCTTACCTTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCTGGAACTGGATGAACTGTCTATCCCCCCCTTTCATCTAATATTGC TCACCAAGGTTCTTCTGTTGATTTAGCAATCTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTATCT TTTGATCAACTACCTTTATTTGTTTGATCTGTTGGTATTACTGCTTTACTTCTTCTTCTTTCTTTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACTGATCGTAATCTTAATACTT CTTTTTTTGACCCTGCTGGAGGAGGAGACCCTATTCTTTATCAACATTTATTT

Type material. Holotype: ♂ deposited in the American Museum of Natural History , New York, NY, USA [ AMNH], illustrated in Fig. 48, bears five labels: four white [11-viii-40. | ♂ | Vizara | 2600’. | Nyasaland | R. C. Wood], [vibius | vibius | ♂], [DNA sample ID: | NVG-19043 B12 | c/o Nick V. Grishin ], [{QR Code} | AMNH _ IZC 00337937 ], and one red [HOLOTYPE ♂ | Semalea malawi | Grishin ].

Type locality. Malawi: ca. 9 mi E of Nkhata Bay, Vizara Rubber Plantation , elevation 2600 ’.

Etymology. The name is given for the country with the type locality. The name is a noun in apposition.

Distribution. Currently known only from the holotype collected in Malawi.