Cecropterus ( Thorybes ) rockiensis, Zhang & Cong & Shen & Song & Grishin, 2023
|
publication ID |
2643-4806 |
|
persistent identifier |
https://treatment.plazi.org/id/03F1878B-FFBB-FF91-269C-FD5FFD4EF15C |
|
treatment provided by |
Felipe |
|
scientific name |
Cecropterus ( Thorybes ) rockiensis |
| status |
new species |
Cecropterus ( Thorybes) rockiensis Grishin, new species
http://zoobank.org/ 7CC2D85B-497D-4A81-9486-82434CCBE143 ( Figs. 27 part, 28, 29 part, 30k, l)
Definition and diagnosis. Both the Z chromosome and the mitogenome trees reveal partitioning of western US populations previously assigned to Cecropterus ( Thorybes) pylades (Scudder, 1870) (type locality in USA: Massachusetts) into two clades: Cecropterus ( Thorybes) indistinctus (Austin & J. Emmel, 1998) , stat. nov. (type locality in the USA: California: San Diego Co., holotype sequenced as NVG-17109A08) and a clade consisting of specimens from and around the Rocky Mountains region in the US, not associated with any available names ( Fig. 27 cyan and purple). The Fst / Gmin between the two clades are 0.37/0.004, and their COI barcodes differ by 1.1% (7 bp). Therefore, the Rocky Mountains clade represents a species-level taxon. This new species is generally similar in appearance to its closest relative, C. indistinctus , in the following combination of characters: stronger checkered fringes (especially on the forewing), ventral wing surface distally paler gray-brown, but not strongly overscaled with white, on average smaller hyaline spots, and less rounded forewings; and differs from it by more prominently checkered fringes, paler ground color, stronger expressed darker framing around (or in place of) hyaline forewing spots, better defined ventral hindwing bands, typically larger hyaline spots and specimen size. In male genitalia, uncus arms are thicker and not as widely separated as in C. ( Thorybes) albosuffusa (H. Freeman, 1943) , stat. nov. (type locality USA: Texas, Ft. Davis), more angled than rounded at the base between them; similar to C. pylades and C. indistinctus and differ from them by somewhat wider slightly converging distad and usually longer compared to tegumen than in the other two species, a notch between ampulla and harpe is typically shallower and wider, harpe is longer, more upcurved. Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in nuclear genome: aly5196.9.2:C915T, aly536.8.1:C750T, aly 1259.10.2:A1122G, aly276561.5.1:G2469A, aly5021.6.4:A1940G and in the COI barcode: A217G, T460C, T596C, A637A. Barcode sequence of the holotype: Sample NVG-22099H03, GenBank OR578714, 658 base pairs: AACTTTATATTTTATTTTCGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAG TTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCA AATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTCTTTATAGT TATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCCCTTATACTAGG GGCTCCTGACATAGCTTTTCCTCGTATAAATAATATAAGATTTTGATTATTACC TCCATCTTTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGAGCAGGTAC TGGATGAACTATTTACCCCCCTTTATCTTCTAATATTGCTCATCAAGGAGCTTC AGTAGATTTAGCAATTTTTTCTTTACATCTTGCTGGAATTTCTTCAATTTTAGG AGCTATTAATTTTATTACAACTATTATCAATATACGAATTAATAATTTATCATT TGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCTTTATTACTTTT ACTTTCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAA CCTAAATACTTCATTTTTTGATCCAGCAGGTGGAGGAGATCCAATTTTATATCA Fig. 29. A map of sequenced specimens from the Cecropterus ACATTTATTT ( Thorybes) pylades group. Different species are shown in different Type material. Holotype: ♂ deposited in the symbols of different colors: C. floridianus sp. n. (larger red California Academy of Sciences, San circles), C. pylades (smaller green circles), C. indistinctus stat.
nov. (cyan diamonds), C. rockiensis sp. n. (purple squares), C. Francisco, CA, USA [CAS], illustrated in Fig. albosuffusa stat. nov. (smaller dark blue downturned triangles), 28, bears six printed (other text but “COLO” and C. oaxacensis sp. n. (larger orange upturned triangle) and on the first label is handwritten) labels: five labeled on the map near their type localities. Type localities for valid names are indicated by tiny circles placed inside symbols, or white [COLO. V-24-79 | Jefferson Co. | Clear (if no specimens from these localities were sequenced) by a small Cr. Cyn.], [Ray E. Stanford | collector], circle framed with the color of the taxon (for C. pylades only). [Collection of | C.D.MacNeill], [DNA sample ID: | NVG-22099H03 | c/o Nick V. Grishin ], [{QR Code} CASENT | 8566837], and one red [ HOLOTYPE ♂ | Cecropterus (Thorybes) | rockiensis Grishin]. Paratypes: 20♂♂ 7♀♀: 1♀ Montana, Yellowstone Co., Billings, 5-Jun-1948, Neil Euting leg. (NVG-22099H04, CASENT8566838) [CAS]; 2♂♂ Nebraska, Sioux Co., Monroe Cyn., 6 mi. N of Harrison, 25-Jun-1983, S. M. Spomer leg. (NVG-22064H01 & H02); Utah: Salt Lake Co.: 1♂ Mill Creek Canyon, 28-Jun-1967, C. J. Callaghan leg. (NVG-22099H07, CASENT8566841) [CAS]; Salt Lake, City Creek Canyon: 1♂ 15-Jun-1930, Lloyd M. Martin leg. (NVG-22094A09) [LACM]; 1♂ 9-Jun-1946, L. I. Hewes leg. (NVG-22099H08, CASENT 8566842) [CAS]; Utah Co.: 1♂ Provo Canyon, 14-Jun-1947, William A. Hammer leg. (NVG-22099G12, CASENT8566834) [CAS]; 1♂ Mt. Timpanogos, 5.6 mi W of Jct. Hwy 189 & 92 on 92, 22-Jul-1946, C. D. MacNeill leg. (NVG-22099H09, CASENT8566843) [CAS]; 1♂ Beaver Co., East Fork Baker Canyon, SH153, Tushar Mts, N side of Beaver Canyon, larva collected on 1-Jul-2022, eclosed 7-Dec-2022, Todd Stout leg. (NVG-22068D07); 1♀ Washington Co., 11-May-1977, D. F. Shillingburg leg. (NVG-22099H06, CASENT8566840) [CAS]; 1♀ Zion National Park, 15-Jun-1928, T. Craig leg. (NVG-22099H10, CASENT8566844) [CAS]; San Juan Co.: 1♀ La Sal Mts., Pack Creek day use area, 31-May- 2016, Robb Hannawacker leg. (NVG-20045E07); 1♂ Abajo Mts., Indian Creek trail, el. 6400'-7400', 8- May-2020, Robb Hannawacker leg. (NVG-20045E08); Colorado: 1♂ Garfield Co., Glenwood Cyn, el. 6200', 8-Jun-1977, Ray E. Stanford leg. (NVG-22099H02, CASENT8566836) [CAS]; 1♂ Eagle Co., Fryingpan River, 10-Jun-1976, Ray E. Stanford leg. (NVG-22099H05, CASENT8566839) [CAS]; Boulder Co.: 1♀ Lefthand Canyon, 16-May-1954, Donald Eff leg. (NVG-22099H01, CASENT8566835) [CAS]; 1♂ Flagstaff Mtn., 15-Jun-1953, Donald Eff leg. (NVG-22094A08) [LACM]; New Mexico: 1♂
Sandoval Co., Cibola National Forest , SH165 4.2 mi S of Placitas, GPS 35.2502, −106.4104, 14-May- 2017, Qian Cong, Jing Zhang & Nick V GoogleMaps . Grishin leg. ( NVG-8800 ); 1♂ 1♀ Lincoln Co., 1.5 mi E of Capitan Gap Rd N water course, el.7000', 10-May-1981, J. McCaffrey leg. ( NVG-15099 H08 & H09) [ FMNH]; 2♂♂ Otero Co. , Lincoln National Forest, La Luz Canyon Rd., 4.8 air mi NE of High Rolls, GPS 32.9992, −105.7759, 21-May-2017, Qian Cong, Jing Zhang & Nick V GoogleMaps . Grishin leg. ( NVG-8970 , Fig. 30l 22094A02 & A03) [ LACM]; 1♂ Lockett Meadow , GPS 35.3605, −111.6208, 24-May-2021, Brian Banker leg. ( NVG-21089 E12); 1♂ Apache Co., Greens Peak area, Pipeline Spring at Fs 117, GPS 34.1413, −109.5809, 25-May-2018, Jing Zhang & Nick V GoogleMaps . Grishin leg. ( NVG-11465 , Fig. 30k); 1♂ Graham Co., Adam's Flat , GPS 32.6508, −109.8125, 23-Apr-2009, Mark Walker leg. ( NVG-18037 D10) GoogleMaps .
Type locality. USA: Colorado, Jefferson Co., Clear Creek Canyon.
Etymology. The name is given for the general area of the distribution of this species, which is in and around the Rocky Mountains (the Rockies), by fusing the Latin suffix - ensis (meaning “from place” or “of place”) with the word “Rockies”. The name is a masculine adjective in the nominative case.
English name. Rocky Mountains Cloudywing.
Distribution. Across the Rocky Mountains and neighboring states: confirmed from Montana, Nebraska, Utah, Colorado, New Mexico, and Arizona.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
