Cecropterus (Thorybes) floridianus, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Butterfly classification and species discovery using genomics, The Taxonomic Report of the International Lepidoptera Survey 11 (3), pp. 1-94 : 55-56

Cecropterus (Thorybes) floridianus Grishin, new species

http://zoobank.org/ EA537AE1-E4FB-4C72-8615-D9BE2DE7336A

( Figs. 27 & 29 parts, 30a–d, 31)

Definition and diagnosis. Both the Z chromosome and the mitogenome trees reveal that eastern US populations previously assigned to Cecropterus (Thorybes) pylades (Scudder, 1870) (type locality in USA: Massachusetts) are not monophyletic, and populations from Florida form a clade sister to three species combined ( C. pylades , C. indistinctus , and C. rockiensis sp. n.) ( Fig. 27). Genetic differentiation between C. pylades and the Floridian populations is notable: Fst / Gmin between the two clades are 0.24/0.003 and the COI barcode difference is 2.3%–2.4% (15–16 bp). Therefore, the Floridian clade represents a distinct species. This new species is similar in appearance to C. pylades in darker ground color, weaker checkered fringes (especially on forewing), weaker developed marginal pale overscaling on wings beneath, larger size, and rounder wings; and differs from it by darker appearance and generally smaller hyaline spots. In the male genitalia, most similar to C. pylades , e.g., uncus arms slightly converge distad, but valva is usually broader, the central bump on its costa is typically less pronounced (in lateral view), harpe is relatively shorter, broader, and straighter, less angled along the ventral margin, and uncus arms are usually shorter compared to tegumen ( Fig. 30a–d). Definitive identification is provided by DNA and a combination of the following characters is diagnostic in nuclear genome: aly 1409.4.2:G1779A, aly383.20.2: T1131 A, aly3507.12.1:G3947C, aly383.21.1:A1654G, aly 1409.4.2:A1477C and in COI barcode: T91 A, T232 C, T355 C, T478 C, T514 A.

Barcode sequence of the holotype: Sample NVG-22032 A09, GenBank OR578715 , 658 base pairs: AACTTTATATTTTATTTTCGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCATTAATTGGAGATGACCAAATTTATAATACT ATTGTCACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTCTTATACTAGGAGCTCCTGATATAGCCTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGAGCAGGTACTGGATGAACTGTTTATCCCCCATTATCTTCCAATATTGC TCACCAAGGAGCTTCAGTAGATTTAGCAATTTTTTCTTTACATCTTGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAACTTATCA TTTGATCAAATACCATTATTTATTTGAGCAGTTGGAATTACAGCTTTATTACTTTTACTTTCACTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA [ USNM], illustrated in Fig. 31, bears four printed labels: three white [ USA:FLA: Volusia Co. | New Smyrna Beach | 3 April 1969 | Leg. G. Rawson], [DNA sample ID: | NVG- 22032A09 | c/o Nick V. Grishin ], [genitalia vial | NVG230917-01 | Nick V. Grishin ], and one red [HOLOTYPE ♂ | Cecropterus (Thorybes) | floridianus Grishin]. Paratypes: 4♂♂ 3♀♀ from USA, Florida: 1♂ Franklin Co., USH98 0.4 mi. S of junction with Co. Rd. 370, 3 air mi N of Alligator Point, GPS 29.9378, −84.3907, 29-Mar-1988, J. M. Burns leg., ( NVG- 22032A08) [ USNM]; 1♀ Dixie Co., 16 km S Steinhatchee, end of Rt. 361, 4-Apr-1988, Scott W. Gross leg. ( NVG- 22032A07) [ USNM]; 1♂ Levy Co., Cedar Key, 25-Jul-1963, C. J. Durden leg. ( NVG- 20062C06) [ TMMC]; 1♀ Alachua Co., Gainesville, 20-Apr-1973, E. C. Knudson leg. ( NVG- 22032A10) [ USNM]; 1♂ Marion Co., Ocala National Forest nr. Juniper Springs, 15-May-1988, Scott W. Gross leg. ( NVG- 22032A12) [ USNM]; 1♀ Volusia Co., New Smyrna Beach, G. W. Rawson leg. 10-Mar-1969 ( NVG- 22032A11) [ USNM]; 1♂ Martin Co., Port Sewall, 16-Mar-1939, genitalia 25-34 J. W. Tilden ( NVG- 22101A01, Fig. 30a) [ CAS].

Type locality. USA: Florida, Volusia Co., New Smyrna Beach .

Etymology. The name for this Floridian species is formed by adding “- us ” and is a masculine adjective.

English name. Florida Cloudywing.

Distribution. Confirmed only from the USA: Florida, but is likely to be found at least in Georgia.