Cecropterus ( Thorybes ) oaxacensis, Zhang & Cong & Shen & Song & Grishin, 2023
|
publication ID |
2643-4806 |
|
persistent identifier |
https://treatment.plazi.org/id/03F1878B-FFB7-FF9F-2667-FC30FB83F5C4 |
|
treatment provided by |
Felipe |
|
scientific name |
Cecropterus ( Thorybes ) oaxacensis |
| status |
new species |
Cecropterus ( Thorybes) oaxacensis Grishin, new species
http://zoobank.org/ 5638F005-DC60-47A2-BB6F-6D9B0650F399
( Figs. 27 & 29 parts, 30p, 32, 33)
Definition and diagnosis. Inspection of genomic trees reveals that a single specimen from Mexico, Oaxaca, initially identified by us as “ Cecropterus albosuffusa ” (curated with “ Cecropterus drusius ” in the collection), is not placed among Cecropterus ( Thorybes) albosuffusa (H. Freeman, 1943) ( type locality USA: Texas, Ft. Davis) specimens we sequenced from across the range ( Fig. 27). This specimen is sister to all analyzed C. albosuffusa , some from Puebla and DF in Mexico. This consistent placement of the specimen in the trees constructed from protein-coding regions in autosomes, Z chromosome, and mitochondrial genome, where all sequenced C. albosuffusa specimens across the range from Arizona and Texas to Pueblo cluster closely together, and its distinction in the COI barcode of 1.2% (8 bp, while C. albosuffusa did not show variation in the barcode) suggest that it represents a distinct species. This new species is diagnosed by white hindwing fringe from vein M 2 to tornus, similar to Cecropterus ( Thorybes) drusius (W. H. Edwards, [1884]) ( type locality in southern Arizona) but has C. albosuffusa -like genitalia with rounded ( Fig. 30p), not claw-shaped ( Fig. 30q) harpe, rounder hindwings in males (in C. drusius males, hindwings are slightly extended at tornus, almost lobed), broad paler “frosty” submarginal area on ventral hindwing, which C. drusius typically lacks (some specimens with narrower pale overscaling), and broader forewing subapical spots in a straight line, each spot is nearly square. In male genitalia ( Fig. 30p), it is most similar to C. albosuffusa ( Fig. 30m –o) but differs in thicker and shorter relative to tegumen uncus arms, broader and more rounded in lateral view tegumen, and broader, rounder and more upturned harpe. In DNA, a combination of the following characters is diagnostic in nuclear genome: aly638.13.2: A120C, aly638.13.2:C165T, aly4592.3.6:T120C, aly4592.3.6:A159T, aly727.34.3:C417T, aly596.8.8:G120G (not A), aly596.8.8:G618G (not A), aly767.17.3:A273A (not G), aly767.17.3:T941T (not G), aly1432.13.4: C50C (not T) and COI barcode: A181G, A421A, T574C, C595C, T604C.
Barcode sequence of the holotype: Sample NVG-19125 B09, GenBank OR578716 , 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTCACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGGGGATTTGGAAATTGATTAATTCCTCTTATATTAGGAGCTCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAACGGAGCAGGTACTGGATGAACTGTTTATCCCCCTTTATCTTCTAATATTGC TCATCAAGGAGCTTCAGTAGATTTAGCAATTTTTTCTTTACATCTTGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCA TTTGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCCTTATTACTTTTACTTTCATTACCTGTTTTAGCTGGAGCTATTACCATATTATTAACTGATCGAAACTTAAATACCT CATTTTTTGATCCTGCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT
Fig. 33. Cecropterus ( Thorybes) oaxacensis sp. n. female, iNaturalist observation 110602850 from Mexico: Oaxaca, San Miguel Tequixtepec , 17-Jun-2014, © John Kemner; photographs show the same individual. Images are color-corrected, and the rightmost is rotated approximately 90° clockwise. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0 /
Type material. Holotype: ♂ deposited in the University of Texas Biodiversity Center collection, Austin, TX, USA [ TMMC], illustrated in Fig. 32, bears four printed labels: three white [ OA.Tlalixtac.002 | 5 mi N Oaxaca | KemnerJ 88138A02], [DNA sample ID: | NVG- 19125B09 | c/o Nick V. Grishin ], [DNA sample ID: | NVG- 22056A03 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Cecropterus (Thorybes) | oaxacensis Grishin], collected by John Kemner on 17-May-1988 (i.e., “88138”: day 138 of 1988).
Type locality. Mexico: Oaxaca, Tlalixtac de Cabrera, Hwy 175, ca. 5 mi north of Oaxaca City .
Etymology. The name is given for the type locality and is a masculine adjective in the nominative case.
English name. Oaxaca Cloudywing.
Distribution. Known only from Mexico: Oaxaca. Specimens from phenotypically similar (but mostly darker-fringed) populations to the north (e.g., Puebla and Ciudad de México) are Cecropterus ( Thorybes) albosuffusa (H. Freeman, 1943) as identified by genomic sequencing ( Fig. 27).
| CC |
CSIRO Canberra Rhizobium Collection |
| TMMC |
Texas Memorial Museum |
| V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
