Telemiades solon Plötz, 1882

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Butterfly classification and species discovery using genomics, The Taxonomic Report of the International Lepidoptera Survey 11 (3), pp. 1-94 : 57-59

Telemiades solon Plötz, 1882 is a junior subjective synonym of Nascus (Bron) broteas (Cramer, 1780)

The name Telemiades solon Plötz, 1882 (type locality in South America), currently applied to a valid species of Nascus Watson, 1893 (type species Papilio phocus Cramer, 1777 ), was proposed in a key with a specimen number 4874 in Berlin collection (MFNB) mentioned and the drawing “t. 154” referenced the numbers t. 149 to t. 159 in his analysis of unpublished illustrations of American Hesperiidae by Plötz, and none of these drawings were copied. The fate of the original Plötz’s illustrations is still unknown (Zhang et al. 2023d). A search of the Hesperiidae holdings in MFNB did not yield the specimen with the number 4874. However, the catalog of the old Hesperiidae collection in MFNB handwritten by Hopffer (Zhang et al. 2023d) has a record for No. 4874: two specimens collected in “Rio” [ Brazil: Rio de Janeiro]. Initially, they were listed as “ sp. ” (i.e., unidentified), but subsequently, “ sp. ” was crossed out, and “ Pherenice Hew. ” was written instead. Eudamus pherenice Hewitson, 1867 (type locality in Brazil) is currently regarded as a junior subjective synonym of Nascus (Nascus) phocus (type locality in Suriname). Thus, the appearance of these two specimens No. 4874 was likely that of Nascus , even if they were misidentified by Hopffer (i.e., they were not pherenice but some other similar species), and thus, if they were T. solon , consistent with the placement of T. solon in Plötz’s key among species currently in Nascus . Therefore, it is possible that the specimen(s) referred to by Plötz as “4874” was (were) listed in the Hopffer catalog for that entry and collected in Southeast Brazil (Rio de Janeiro), a detail not given in the original description of T. solon .

Evans (1952) applied the name “ Nascus solon ” to an Amazonian species not known from Southeast Brazil. This discrepancy found after an inspection of the Berlin collection catalog prompted us to study the original description of T. solon more closely. We concluded that Evans misidentified T. solon because the species Evans identified as “ N. solon ” does not agree with the original description of T. solon . Most significantly, Plötz mentions a brown “hair pencil” (a tuft of long hair-like scales) at the base of cell 1 b [i.e., 1A+2A-3A] on ventral hindwing in T. solon , but this tuft is pale, mostly yellow, in Evans’ “ N. solon .” Then, in T. solon , pale spots in the middle of the forewing are close together and “only separated by veins” (Plötz 1882); but in “ N. solon ”, the spot in cell M 3 -CuA 1 does not reach the cell origin, which is filled with the ground color (yellow-brown) for at least half of the width of the pale spot in cell CuA 1 - CuA 2 along vein CuA 1. Furthermore, in T. solon , the hyaline spot in forewing cell M 1 -M 2 is small, a pale spot by the costa in the middle of the forewing is mentioned only as “beneath, costal margin is also spotted with pale”, and the ventral hindwing is with brown “crossbar in cell 7 [Sc+R 1 -RS] and in the discal cell”. In contrast, in “ N. solon ”, the spot in the forewing cell M 1 -M 2 is nearly the same size as the spot in the cell R 5 -M 1, forewing is with a well-developed hyaline spot by mid-costa, which is seen from the dorsal side as well (hyaline!), hindwing is with weakly developed or missing cental brown spot in the discal cell, and the spot in the cell Sc+R 1 -RS is small, not a “crossbar”. Therefore, Evans’ “ N. solon ” is not conspecific with the true T. solon .

Next, we searched for specimens that agree with the original description of T. solon . The specimen we found to match the description closely was No. 4865 in MFNB. This specimen was previously curated as a type of Netrocoryne seneca Plötz, 1882 (type locality Brazil) because No. 4865 was mentioned by Plötz (1882) in the original description of N. seneca . However, this specimen is a pseudotype because it agrees neither with the original description nor with a copy of Plötz’s unpublished illustration of N. seneca (Zhang et al. 2023d) . It is possible that due to some mistakes in referencing the MFNB specimen numbers, this specimen No. 4865 was instead (or in addition) a syntype of T. solon . However, we do not have defendable evidence to support this hypothesis. Therefore, we proceeded with the neotype designation because there is an exceptional need to clarify both the taxonomic identity and the type locality of T. solon . This taxon has been misidentified by Evans (1952), who applied this name to a species that does not agree with the original description of T. solon . This mistake creates inconsistencies in the literature and the potential for further destabilization of nomenclature due to the existence of additional species in this group unless the name T. solon is objectively defined by the neotype. Therefore, N.V. G. designates the specimen No. 4865 in MFNB illustrated in Fig. 1a–c in Zhang et al. (2023d) (DNA sample NVG-15031F11) as the neotype of Telemiades solon Plötz, 1882 .

Our neotype of T. solon satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of Telemiades solon Plötz, 1882 , which has been misinterpreted and attributed to a different species that does not agree with the original description of T. solon , and to detail its type locality that was given only generally (as “South America”) in the original and we regard them as follows: forewing with a hyaline spot in cell CuA 2 -1A+2A, hyaline spots in the middle of the forewing are crowded together and separated only by veins, hyaline spots in cells M 1 -M 2 and M 2 -M 3 are small, and the former is merged with the apical spots that together form an oval-shaped hyaline patch separated by veins, a hyaline spot in cell R 2 -R 3 is merged with this patch and not offset basad, the hyaline spot is absent by the costal margin near its middle, but the costal margin with a pale spot in the middle beneath; ground color of wings olive-brown, the base of ventral hindwing and most of ventral hindwing are clay-yellow, ventral hindwing with brown crossbars in cell Sc+R 1 -RS and the discal cell, and, in addition to the broadly brown outer margin area, with a postdiscal brown band and a brown tuft of hair-like scales at the base of cell 1A+2A-3A; 75.3.3. The neotype specimen is a male bearing eight labels (1 st red, 3 rd bluish-greenish, the last orange, and others white): [typus], [4865], [Bahia Sello], [GEN.PREP., | MIELKE | 1996], [seneca | Pl. | type], [DNA sample ID: | NVG-15031F11 | c/o Nick V. Grishin ], [{QR Code} http://coll.mfn-berlin.de/u/ | 940b3c], [not a type specimen of | Netrocoryne seneca | Plötz, 1882 | determined by Zhang, | Cong et al. 2023] and illustrated in Fig. 1a–c (without the last label, which was added later) in Zhang et al. (2023d); the neotype has a chipped off tornus on both hindwings; 75.3.4. We searched for syntypes of T. solon in the MFNB collection because the original description specified specimen(s) with the number 4874 in Berlin. While there was an entry in the old collection catalog with No. 4874 listing two specimens, we could not find them among Hesperiidae holdings, and therefore, we believe that syntypes were lost; 75.3.5. The neotype closely agrees with the original description of T. solon in all (but one) characters, as evidenced by comparing the neotype illustrated in Fig. 1a–c in Zhang et al. (2023d) with the characters for this taxon given in the original description (Plötz 1882) and listed above (75.3.2.); the only discrepancy is that palpi are nearly white beneath, not clay-yellow (could have been discolored) as stated by Plötz (1882); 75.3.6. The neotype is from Brazil: Bahia, which is within the original type locality given as “South America”; 75.3.7. The neotype is in the collection of the Museum für Naturkunde, Berlin, Germany (MFNB).

Genomic sequencing confirms the phenotypic assessment of the T. solon neotype as a specimen of Nascus (Bron) broteas (Cramer, 1780) (type locality in Suriname) (Zhang et al. 2023d) because it groups with specimens of the latter species in the tree ( Fig. 34). Notably, Draudt (1922) has already placed T. solon within his Nascus cous (Möschler, 1879) (listing Nascus eugamon Godman & Salvin, 1893 as a synonym of the latter), and expressed an opinion that these may be males of N. broteas , which was then known only by females. Therefore, as a result of the neotype designation, Telemiades solon Plötz, 1882 , syn. nov. becomes a junior subjective synonym of Nascus (Bron) broteas (Cramer, 1780) . The COI barcode sequence of T. solon neotype, sample NVG-15031F11, GenBank OR578717, 658 base pairs, is: AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTCTTAGATTACTAATTCGAACTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTCTTATACTAGGAGCTCCTGATATAGCATTTCCACGAA TAAATAACATAAGATTTTGATTATTACCTCCATCATTAACATTATTAATTTCAAGAAGAATTGTCGAAAATGGTGCTGGTACTGGATGAACAGTTTACCCCCCTTTATCAGCAAATATTGC TCACCAAGGTTCTTCCGTAGATTTAGCAATCTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCT TTTGATCAAATACCATTATTTATTTGAGCTGTAGGAATTACAGCATTATTATTACTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT CTTTCTTTGACCCAGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT