Nascus (Bron) lux, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Butterfly classification and species discovery using genomics, The Taxonomic Report of the International Lepidoptera Survey 11 (3), pp. 1-94 : 60-61

Nascus (Bron) lux Grishin, new species

http://zoobank.org/ 4B4097CE-A43D-4ABB-A5E5-1EAE4FD5C049

( Figs. 34 part, 35)

Definition and diagnosis. Inspection of genomic trees reveals that Amazonian populations, which Evans (1952) considered to be conspecific with Nascus corilla Evans, 1952 , stat. nov. (type locality in Venezuela) and misidentified as Telemiades solon Plötz, 1882 (type locality in Brazil: Bahia) as determined above, are genetically differentiated from N. corilla with Fst / Gmin of 0.48/0.003 (although their COI barcodes do not reveal differences but in 1 or 2 base pairs) and therefore represent a distinct species ( Fig. 34). This species does not have a name. This new species keys to “ Nascus solon solon ” D.5.3(b) in Evans (1952) and is distinguished from its closest relative, N. corilla , stat. nov. (see above), by pale-yellow to orange-yellow patches of scales, variable in their expression, dividing the brown outer marginal area on the ventral hindwing (that is solid dark brown in N. corilla ) into narrow postdiscal and broad submarginal bands in males, and usually having five (not four) subapical hyaline spots in females; and from other species of Nascus by the following combination of characters: forewing apical spot in cell R 2 - R 3 is in line with others, not offset basad; yellow or pale brown tuft of long scales at the base of cell 1A+2A-3A on ventral hindwing; palpi beneath and cheeks are white; prominent hyaline spot in the middle of forewing by costal margin in males; forewing typically larger than 28 mm in males and 30 mm in females. A combination of the following nuclear genomic characters is diagnostic: aly525.35.1:C54T, aly214.21.1:C303T, aly214.21.1:G312A, aly26.5.3:C294T, aly50.27.2:A51G.

Barcode sequence of the holotype: Sample NVG-21012 D07, GenBank OR578718 , 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTCTTAGATTATTAATTCGAACTGAATTAGGCACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACA ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGACTAGTACCTCTTATATTAGGAGCTCCTGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGATTATTACCTCCATCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGTACTGGTTGAACAGTTTACCCCCCTTTATCAGCAAATATTGC TCACCAAGGATCTTCTGTAGATTTAGCAATTTTTTCATTACATTTAGCAGGAATTTCCTCAATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCT TTTGATCAAATACCATTATTTATTTGAGCTGTAGGTATTACAGCTTTATTATTATTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT CTTTTTTTGATCCTGCAGGAGGAGGTGATCCAATTCTTTATCAACATTTATTT

Type material. Holotype: ♂ deposited in the Carnegie Museum of Natural History , Pittsburgh, PA, USA [ CMNH], illustrated in Fig. 35, bears four printed (last two digits of the year handwritten) labels: three

ID: | NVG-21012 D07 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Nascus (Bron) | lux Grishin]. Paratypes: 4♂♂, one from each locality Peru: Huanuco, Tingo Maria, 800m, May-Jun-1994, genitalia X-5174 J. M. Burns 2002 ( NVG-17103 E04, USNMENT00913776); Brazil: Rondônia, 62 km S Ariquemes, Fazenda Rancho Grande, elevation 165m, GPS −10.53, −63.80, 27-Aug-8-Sep-1994, Ron Leuschner leg. ( NVG-17103 G06, USNMENT00913805); Amazonas , Maues , Rio Preto , 15-25-Nov-2007 ( NVG-18088 H10); and French Guiana: Roura , Coralie , GPS 4.5083, −52.3750, L. Sénécaux & A. Docquin leg. 24-Jul-1992 ( NVG-18098 E10, H3956) .

Type locality. Brazil: Amapá , Rio Uaçá region (“Uassa Swamp”), which is by the border between Brazil and French Guyana.

Etymology. In Latin, lux means “light” and refers to the lighter (i.e., paler) overall appearance of this sunny species, light—instead of brown—tuft of scales on the hindwing (a beam of light), and a sprinkle of light scales between the postdiscal and submarginal brown bands on the ventral hindwing (a phenotypic character that typically separates this species from its closest relative). The name is a noun in apposition.

Distribution. Generally, in and around the Amazonian region in South America. This species has been recorded from French Guiana, Peru, Ecuador, and Brazil (Amapá, Amazonas, Rondônia).

Comment. This name is proposed for Evans’ concept of “ Nascus solon solon ” (Evans misidentified Telemiades solon Plötz, 1882 ), and due to genetic differentiation, the two taxa Evans considered to be subspecies: “ Nascus solon corilla ” and “ Nascus solon solon ” are distinct species: Nascus corilla and Nascus lux sp. n., respectively.