Cogia moschus (W. H. Edwards, 1882)

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Butterfly classification and species discovery using genomics, The Taxonomic Report of the International Lepidoptera Survey 11 (3), pp. 1-94 : 62-64

Cogia moschus (W. H. Edwards, 1882) is a species distinct from Cogia caicus ( Herrich-Schäffer, 1869)

We find the genetic differentiation between Cogia caicus ( Herrich-Schäffer, 1869) (type locality likely in Mexico: Oaxaca, as deduced above, lectotype sequenced as NVG-15032A02, in MFNB) and Cogia caicus moschus (W. H. Edwards, 1882) (type locality in USA: AZ, Graham Co., lectotype sequenced as NVG-15097H06, in CMNH) to be of a magnitude suggestive of distinct species: Fst / Gmin /COI differences are 0.50/0.003/0.9% (6 bp) ( Fig. 37). Therefore, we propose that Cogia moschus (W. H. Edwards, 1882) , stat. rest. is a species-level taxon.

http://zoobank.org/ 00E80EF8-25B0-4A36-97FC-E6157CD96DE5 ( Figs. 37 part, 38, 39a)

Definition and diagnosis. In addition to Cogia moschus (W. H. Edwards, 1882) (type locality in USA: AZ, Graham Co.) and Cogia caicus ( Herrich-Schäffer, 1869) (type locality likely in Mexico: Oaxaca), genomic trees reveal a third lineage of similar genetic differentiation ( Fig. 37 red) with Fst/Gmin/COI differences from the former and the latter, respectively: 0.49/0.009/0.9% (6 bp) and 0.4/0.006/0.5% (3 bp) that represents a species. This new species differs from its two close relatives by being darker overall, smaller (or lacking) hyaline spots, and darker palpi beneath. Male genitalia are variable, but the harpe typically is broader, rounder, and dorsally with more robust teeth on a shorter ridge near the ampulla; aedeagus with a smaller number of cornuti (Fig. 39). A combination of the following characters in the COI barcode is diagnostic: A40A, C343C, T349T, T386T, A481G, T556A. Barcode sequence of the holotype: Sample NVG-22079A01, GenBank OR578719, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGTTTATTAATTCGTACTGAATTAG GAACTCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTT TTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCCTTAATATTAGGAGCTCCTGATATAGC TTTTCCTCGTATAAATAATATAAGATTTTGATTACTTCCCCCATCATTAACATTATTAATTTCTAGAAGTATTGTAG AAAATGGTGCTGGTACTGGATGAACAGTATATCCCCCCCTTTCATCAAATATTGCACATCAAGGTTCATCAGTAGAT TTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCATCTATTTTAGGTGCTATTAATTTTATTACTACAATTATTAA TATACGAATTAGAAATTTGTCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACAGCTTTATTACTTT TACTTTCTTTACCTGTATTAGCTGGTGCTATTACTATACTTTTAACAGATCGAAATCTTAATACATCATTTTTTGAT CCTGCTGGAGGAGGAGACCCTATTTTATATCAACATTTATTT Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Gainesville, FL, USA [MGCL], illustrated in Fig. 38, bears five printed labels: four white Fig. 39. Male genitalia of Cogia in lateral view (left valva separated and rotated [ Antigua, Sacatepequez | Guatemala | September 16, 1993 | 180°). a) C. chiagua sp. n. paratype, D.L.Lindsley], [ Cogia Butler | caicus (Herrich-Schäffer) | caicus mini-slide 153, data in text. b) C. moschus (Herrich-Schäffer) ], [D.L. Lindsley colln. | MGCL Accession | # stat. rest., Mexico: N Sonora, Morrison 2008 -20], [DNA sample ID: | NVG-22079A01 | c/o Nick V. leg., BMNH(E) 1236437, mini-slide 151.

Photographs by N. V. G. © The Trustees of the Grishin ], and one red [HOLOTYPE ♂ | Cogia chiagua | Grishin ]. Natural History Museum London and are made Paratypes: 3♂♂, 1♀ : 1♂ Mexico, Chiapas, Comitán, Laguna available under Creative Commons License 4.0 Chamula , 7100’, 13-May-1987, C.J. Durden leg. ( NVG-19124 H05) (https://creativecommons.org/licenses/by/4.0/). [ TMMC] and Guatemala: 1♂ Panajachel, 2-Jun-1968, Beals leg. ( NVG-17109 F09) [ LACM] and Duenas, G.C. Champion leg. [ BMNH]: 1♂ ( BMNH (E) 1236437, genitalia mini-slide 153, Fig. 39a) and 1♀.

Etymology. The name is a fusion of Chia [pas] + Gua [temala] for the known distribution of this species and is a feminine noun in apposition.

Distribution. Currently known from Mexico: Chiapas and from Guatemala.