Grishin, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Butterfly classification and species discovery using genomics, The Taxonomic Report of the International Lepidoptera Survey 11 (3), pp. 1-94 : 19-21

Hyperanartia Grishin , new subgenus

http://zoobank.org/ D264019C-2106-4F29-9F1F-7830321FAD68

Type species. Vanessa dione Latreille, [1813] .

Definition. The genus Hypanartia Hübner, [1821] (type species Hypanartia demonica Hübner, [1821] , which is a junior subjective synonym of Papilio lethe Fabricius, 1793 ) has been divided into two species groups: the paullus group (includes the type species of Hypanartia ) and the dione group (Willmott et al. 2001; Llorente et al. 2023). Our genomic tree shows this split ( Fig. 7) and is consistent with the cladogram constructed using morphological characters (Willmott et al. 2001). Here, the division of Hypanartia into two clades is formalized, and the new subgenus is proposed to encompass the dione group. This new subgenus is distinguished from the nominotypical subgenus by male genitalia: nearly triangular in lateral view valvae, separated at the base in ventral view; vinculum broader near the base of succus in lateral view; saccus with narrower anterior part (at least in lateral view); and gnathos continuously sclerotized, joined. See Willmott, Hall, and Lamas (2001) for additional information and illustrations. A combination of the following nuclear genomic base pairs is diagnostic: hm2021257-RA.1: A261G, hm2002154-RA.32:T1114A, hm2013826-RA.2:G702A, hm2006214-RA.3:T888C, hm2005917-RA. 1:C3222G.

Etymology. The Latin prefix hypo - means “below”, “beneath”, and sometimes “less than”. Species of the new subgenus are clearly more than that, and this prefix is replaced with hyper - (i.e., “above”, “high”, “beyond”, “excessive”) for an exaggerated look of some of these butterflies: typically with more angular wings, longer tails, and bolder white spots. The name is a feminine noun in the nominative singular.

Willmott & J. Hall, 2001, Eurema charon Hewitson, 1878 , Hypanartia christophori Jasinski, 1998 , Hypanartia cinderella Lamas, Willmott & J. Hall, 2001 , Hypanartia fassli Willmott, J. Hall & Lamas, 2001 , Eurema kefersteini Doubleday, [1847] , Eurema lindigii C. Felder & R. Felder, 1862 , Hypanartia splendida Rothschild, 1903 , and Hypanartia trimaculata Willmott, J. Hall & Lamas, 2001 (including their subspecies and synonyms).

Parent taxon. Genus Hypanartia Hübner, [1821] .

Comments. In their genetic differentiation ( Fig. 7), the two subgenera of Hypanartia are approximately the same as some subgenera in Nymphalis Kluk, 1780 (type species Papilio polychloros Linnaeus, 1758 ). Therefore, they are phylogenetically equivalent to the two subgenera Nymphalis and Aglais Dalman, 1816 (type species Papilio urticae Linnaeus, 1758 ) (i.e., the same level in the tree), and are stronger differentiated genetically than Nymphalis from Polygonia Hübner, [1819] (type species Papilio c-aureum Linnaeus, 1758 ).

from Vanessa hippomene (Hübner, 1823)

Genomic sequencing reveals notable genetic differentiation between the nominotypical Vanessa hippomene (Hübner, 1823) (type locality not given, deduced by wing shape and patterns of a specimen shown in the original illustration to be in South Africa) and Vanessa hippomene madegassorum (Aurivillius, 1899) (type locality in Madagascar) ( Fig. 7). The COI barcodes of the two taxa differ by 2.9% (19 bp). Phenotypically, V. h. madegassorum is characterized by more prominently scalloped (even toothed at veins) wing margins, a longer and thinner major hindwing tail at the end of vein M 3, a second, shorter tail at the end of vein CuA 2 (absent in the nominotypical V. hippomene ), orange (rather than yellower) forewing band, green scaling by the forewing apex beneath, and reduced pale scaling and spot by mid-costa on the ventral hindwing ( Fig. 8). Taken together, these observations suggest that Vanessa madegassorum (Aurivillius, 1899) , stat. nov. is a species distinct from Vanessa hippomene (Hübner, 1823) . Vanessa madegassorum stat. nov. is known only from Madagascar, with the last reported record from 1976 ( Lees et al. 2003), and may be of conservation concern, if not already extinct. The COI barcode sequence of V. madegassorum stat. nov., sample NVG-19122B12, GenBank accession OR578710, 658 base pairs, is:

TACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTTGGAACTTCACTTAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACA ATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGTTTTGGTAATTGATTAATTCCACTTATATTAGGAGCCCCTGATATAGCTTTTCCACGTA TAAATAATATAAGATTTTGACTTTTACCCCCTTCATTAATATTATTAATTTCTAGTAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGC TCATAGAGGATCTTCTGTAGATCTAGCAATTTTTTCATTACATTTAGCTGGAATTTCCTCTATTTTAGGAGCAATTAATTTTATTACTACTATTATTAATATACGAATTAATAGAATATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGTATTACAGCTTTACTTTTATTAATCTCTCTTCCTGTTTTAGCTGGAGCTATTACTATACTTCTAACAGATCGAAATATTAATACAT CATTTTTTGATCCTGCGGGAGGAGGAGACCCAATTCTTTATCAACATTTATTT

Subgenera in Vanessa [Fabricius], 1807

The genus Vanessa [Fabricius], 1807 (type species Papilio atalanta Linnaeus, 1758 ) has been divided into five species groups: the atalanta group (includes the type species of Vanessa ), the cardui group ( Papilio cardui Linnaeus, 1758 is the type species of Cynthia [Fabricius], 1807), the carye group ( Hamadryas carye Hübner, 1812 is the type species of Neofieldia Özdikmen, 2008 ), the itea group ( Wahlberg and Rubinoff 2011). Because four of these groups are characterized by notable genetic differentiation ( Fig. 7), we propose to treat the two names as subgenera: Neofieldia Özdikmen, 2008 , stat. rest. and Bassaris Hübner, [1821] , stat. rev. and leave Cynthia as a junior subjective synonym of Vanessa . The hippomene species group does not have a name. It is described below.