Argyrogrammana astuta, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Butterfly classification and species discovery using genomics, The Taxonomic Report of the International Lepidoptera Survey 11 (3), pp. 1-94 : 28-29

Argyrogrammana astuta Grishin, new species

http://zoobank.org/ C3B104C6-18F0-4FAE-8506-DD345ED63531

( Figs. 18, 19)

Definition and diagnosis. Genomic sequencing of the holotype of Argyrogrammana praestigiosa (Stichel, 1929) (type locality not specified, likely the Guianas) (in MFNB, NVG-18077D12) reveals that a sequenced specimen identified as A. praestigiosa from southeastern Peru (illustrated in Fig. 11 in Hall et al. (2023)) is genetically distant from it with COI barcodes differing by 2.6% (17 bp). In the presence of phenotypic differences, such as those in wing patterns discussed in detail by Hall et al. (2023), the observed genetic differentiation suggests that the specimen from Peru is not A. praestigiosa but a distinct species. This species is new, and its males (female is unknown) differ from superficially most similar A. praestigiosa by the characters described for “west Amazonian males” in Hall et al. (2023), such as more extensive orange coloration of dorsal wings, i.e., basal area of forewing with three orange bands and in some specimens an orange marginal streak near tornus, hindwing with more orange scaling by its apex,

Fig. 19. Argyrogrammana astuta sp. n. iNaturalist observations from Peru: Madre de Dios, Tambopata: a) 175878841 GPS −12.6060, −69.0324, 27-Jul-2023 © danielblanco521; b) 67719625 Tambopata , GPS −12.0467, −69.6766, 29-Sep-2017, © Ken Kertell; c) 94229584 ventral of b) © David Geale. Images are color-corrected and rotated. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0 /

in A. praestigiosa ). Beneath, brown scaling is less extensive, pale bands are wider, with more orange scales in them (particularly toward wing margins), and with sharper edges, especially towards the outer margin; submarginal dark spots are more even, e.g., on hindwing spots in cells M 1 -M 2 and M 2 -M 3 are not particularly larger than others (they are larger and more pointed in A. praestigiosa ). The dorsal side of the abdomen with a brown central spot at the base of each segment (entirely orange in A. praestigiosa ). Other species of Argyrogrammana are more distant and different, e.g., the next closest species is A. glaucopis (H. Bates, 1868) , which is characterized by much less extensive orange coloration and additional blue spots on the forewing, and A. caerulea J. Hall, 2023 has even more extensive blue forewing patches.

Barcode sequence of the holotype: Sample NVG-19029 F11, GenBank OR578713 , 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTTTAAGTTTATTAATTCGTATAGAATTAGGTAATCCAAACTCATTAATTGGTAATGACCAAATTTATAATACA ATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGGTTTGGAAATTGATTAATTCCTTTAATATTAGGGGCTCCTGATATAGCATTTCCACGAA TAAATAACATAAGTTTTTGATTATTACCCCCCTCCTTAATTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCTCTTTCTTCTAATATTGC TCATAGAGGCTCATCCGTTGATTTAGCCATTTTTTCTCTTCATTTAGCTGGGATTTCTTCCATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGTATTAATAATATAGCT TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTCTTCTTTTATTATTATCATTACCAGTTTTAGCTGGAGCTATTACCATATTATTAACAGATCGTAATTTAAATACAT CATTTTTTGATCCTGCTGGAGGTGGAGATCCTATTTTATACCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History , Washington, DC, USA [ USNM], illustrated in Fig. 18 (and Fig. 11 in Hall et al. (2023) left-right inverted—i.e., mirror image of the specimen—and with imperfections edited out), bears four printed labels: three white [ PERU, Madre de Dios | Tambopata Reserve | 12° 50’S 69° 17’W, 300m | 28 Oct 1991 | Leg. R. Robbins], [DNA sample ID: | NVG-19029 F11 | c/o Nick V. Grishin ], [USNMENT | {QR Code} | 01544363], and one red [HOLOTYPE ♂ | Argyrogrammana | astuta Grishin].

Type locality. Peru: Madre de Dios, Tambopata National Reserve , elevation 300 m, GPS −12.83, −69.28 .

Etymology. In Latin, astutus is astute, cunning, clever, sly, and artful, and praestigiosus is deceptive and misleading. This new species was skillfully hiding among the deceitful A. praestigiosa until genomic sequencing revealed its distinction. The name is a feminine adjective.

Distribution. This species is genetically confirmed only from the holotype collected in southeastern Peru; however, it is expected at least in the southwestern Amazonian Basin (Fig. 19).

Comments. Hall et al. (2023) described in detail wing pattern differences between populations of A. praestigiosa , concluding that they represent intraspecific variation due to the lack of apparent differences in genitalia and citing phenotypic intermediates. Argyrogrammana astuta sp. n. corresponds to the “west Amazonian” A. praestigiosa of Hall et al. (2023). It is possible that A. praestigiosa is even more deceitful, and additional variation described by Hall et al. (2023) may refer to additional species in this complex.