Emesis ( Tenedia ) nimia, Grishin, 2024
|
publication ID |
https://doi.org/10.5281/zenodo.14662420 |
|
publication LSID |
lsid:zoobank.org:pub:EFB3CF5F-6748-41D0-B905-E9CFC8F54D2C |
|
persistent identifier |
https://treatment.plazi.org/id/03BF8783-FF9D-FFDC-FF23-FC689F38FD3A |
|
treatment provided by |
Felipe |
|
scientific name |
Emesis ( Tenedia ) nimia |
| status |
new species |
Emesis ( Tenedia) nimia Grishin, new species
http://zoobank.org/ 90A323A7-029F-4C4D-92DC-FEC247F900FD
( Fig. 3 View Figure 3 part, 27–28, 95–96)
Definition and diagnosis. Genomic analysis of a female Emesis specimen from Panama with angular wings and a very prominent pale postdiscal half-band on the forewing ( Fig. 27–28 View Figures 27–48 ) reveals that it is genetically unique and differentiated from all others we sequenced at the species level ( Fig. 3 View Figure 3 ), e.g., its COI barcode differs from the closest species Emesis ( Tenedia) tenedia C. Felder and R. Felder, 1861 by 2.7% (18 bp). Therefore, it represents a new species. This new species is closest to E. tenedia in females having a sharply defined cream-yellow postdiscal band in the anterior half of the forewing, but this band is deeper yellow and with the spot in the cell M 3 -CuA 1 about half of the width of the spot in the cell M 2 -M 3 (usually wider in E. tenedia ) and differs in generally more angular wings with a stronger hooked forewing apex. In other species, the outer margin of the forewing is less wavy, with reduced concavity near the apex and in the cell CuA 1 -CuA 2. In female genitalia ( Fig. 95–96 View Figures 81–106 ), ductus bursae is not looped, two small (less than ⅛ of the corpus diameter) horn-like signa at the caudal end of the spherical corpus bursae, sternite VII (“genital plate”) is trapezoidal, weakly sclerotized especially at the margins, with a straight posterior margin. Due to unexplored phenotypic variation and males still unknown, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne7345.5.3:T40C, cne7345.5.3:A42T, cne3225.1.1:T168C, cne285.13.6:A126T, cne13338.1.2:A216T, cne26870.1.5:G63G (not A), cne26870.1.5:C64C (not A), cne 1953.11.4:A45A (not G), cne 1953.11.4:T57T (not G), cne5876.11.2:T321T (not C), and COI barcode: T92C, T121C, A238G, A334G, T475C, T523C.
Barcode sequence of the holotype. Sample NVG-18044H02, GenBank PQ203553, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTCTATTAATTCGAATAGAATTAGGAACTTCAG GATTTCTAATTGGTGATGATCAAATTTATAATACCATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATT ATAATTGGAGGATTTGGTAATTGATTAGTACCATTAATATTAGGAGCTCCAGATATAGCTTTCCCGCGAATAAATAACATAAGAT TTTGATTATTACCCCCCTCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACGGTGTACCC CCCACTTTCATCTAATATTGCCCATAGAGGCTCATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTCTATC TTAGGAGCAATTAATTTTATCACTACTATTATTAATATACGTATTAACAATTTATCATTTGATCAAATACCCTTATTTATTTGAT CAGTAGGTATCACAGCACTTTTACTTTTATTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTATTAACAGATCGTAATTT AAATACATCATTTTTTGACCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 27–28 View Figures 27–48 , bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PANAMA: CHIRIQUI | Cerro Colorado 1450m | 8°32’N 81°47’W | 9.VIII.1979 | leg. G.B.Small], [DNA sample ID: | NVG-18044H02 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114G11 | c/o Nick V. Grishin ], [genitalia | NVG240817-16 | Nick V. Grishin ], [USNMENT | {QR Code} | 01532799], and one red [ HOLOTYPE ♀ | Emesis (Tenedia) | nimia Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection.
Type locality. Panama: Chiriquí Province, Cerro Colorado, elevation 1450 m., approx. GPS 8.533, −81.783.
Etymology. In Latin, nimius means excessive, extreme, or exaggerated and is given for the extreme looks of this species, both in its more angular wing shape and contrasty yellow patch cut through by dark veins. The name is a feminine adjective.
Distribution. Currently known only from the holotype collected in western Panama.
| USNM |
Smithsonian Institution, National Museum of Natural History |
| V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
