Emesis (Aphacitis) pallescens, Grishin, 2024

Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V., 2024, Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae), Insecta Mundi 2024 (82), pp. 1-48 : 29-30

Emesis (Aphacitis) pallescens Grishin, new species

http://zoobank.org/ 619F1F8C-33EA-4B25-936D-6B2628D6B3EC

( Fig. 5 part, 71–72, 127–128)

Definition and diagnosis. This new species ( Fig. 5 magenta) is sister to both Emesis (Aphacitis) glaucescens Talbot, 1929 (type locality in Colombia: Montepa) and Emesis (Aphacitis) furvescens , new species (type locality in Panama: Darién) and genetically differentiated from them at the species level, e.g., their COI barcodes differ by 1.2% (8 bp, moderate, but accompanied by the nuclear genome differentiation and phenotypic differences) from E. glaucescens and 2.0% (13 bp) from E. furvescens . This new species is phenotypically most similar to E. glaucescens and E. furvescens in the general wing pattern of males (female unknown), e.g., all three species have a nearly solid-brown outer border (with pale spots in some species) on the ventral side of all wings and developed pale overscaling in the subapical area of the dorsal forewing, but differs from others by being paler overall, particularly in the ground color of the dorsal side and reduced white subapical frosting, thus is more similar in appearance of the dorsal side to Emesis (Aphacitis) aurimna (Boisduval, 1870) (type locality in Colombia). Ventrally with reduced brown bands and lines compared to E. glaucescens and E. furvescens , and more orange in the submarginal area of the forewing than E. glaucescens . Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne213.7.2:G664T, cne213.7.2:A679T, cne 1255.2.6:G267A, cne 1255.2.6:A271G, cne 1255.2.6:T298G, cne953.8.8:T93T (not C), cne953.8.8:G108G (not A), cne 2149.1.2:C63C (not G), cne 2149.1.2:A90A (not T), cne6935.6.4:A218A (not C), and COI barcode: G200G, T355A, T490C, T514C, A526C.

Barcode sequence of the holotype. Sample NVG-18044C07, GenBank PQ203566, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTCGGTACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACCTCAG GTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGAGGATTTGGTAACTGATTAGTTCCATTAATATTAGGAGCACCTGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGACTTTTACCACCATCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCAAATATTGCCCATGGAGGAGCCTCAGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATCTCATCTATT TTAGGAGCAATTAATTTTATCACAACAATCATTAATATACGTATTAATAATATATCATTTGACCAAATACCATTATTTGTTTGAT CCGTTGGAATTACCGCTCTTTTACTTTTACTGTCTCTTCCAGTTTTAGCCGGAGCTATTACCATATTATTAACAGATCGTAATTT AAATACATCTTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 71–72 , bears the following six printed rectangular labels, five white: [ PANAMA: Panama | Cerro Jefe 900m | 9°14’N 79°22’W | 1 April 1979 | leg. G. B. Small], [DNA sample ID: | NVG-18044C07 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114H10 | c/o Nick V. Grishin ], [genitalia | NVG240817-29 | Nick V. Grishin ], [USNMENT | {QR Code} | 01466353], and one red [HOLOTYPE ♂ | Emesis (Aphacitis) | pallescens Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection.

Type locality. Panama: Panamá Province, Cerro Jefe, elevation 900 m, GPS 9.233, −79.367.

Etymology. In Latin, pallescens means becoming pale or turning pale. The refers to the paler tones of this species compared to its relatives, uses the same ending - escens, as other species in this group, and is a participle.

Distribution. Currently known only from the holotype collected in central Panama.

Figures

Figure 5. Phylogenetic trees of Emesis (Aphacitis) species inferred from protein-coding regions ina) the nuclear genome (autosomes), based on 3,692,175 positions, b) the Z chromosome, based on 315,075 positions, andc) the mitochondrial genome: E. aurichica sp. n. (green), E. pruinapicalis sp. n. (red), E. auripana sp. n. (purple), E. aurimna (olive), E. parvissima stat. nov. (blue), E. pallescens sp. n. (magenta), E. furvescens sp. n. (aquamarine), E. glaucescens (gray), E. castigata (pink), E. condigna (brown), E. andigna sp. n. (cyan), E. luxata sp. n. (orange), and E. opaca (lime). See Fig. 1 caption for other notations.

Figures 71–80. Holotypes (unless indicated) of Emesis (Aphacitis), and data in text. 71–72) E. (A.) pallescens sp. n. 73–78) E. (A.) andigna sp. n.: 75–76) Paratype NVG-18052G01 and 77–78) paratype NVG-18039E12. 79–80) E. (A.) luxata sp. n.